hisat-3n/aligner_seed2.h

4292 lines
128 KiB
C
Raw Normal View History

2025-01-18 13:09:52 +00:00
/*
* Copyright 2011, Ben Langmead <langmea@cs.jhu.edu>
*
* This file is part of Bowtie 2.
*
* Bowtie 2 is free software: you can redistribute it and/or modify
* it under the terms of the GNU General Public License as published by
* the Free Software Foundation, either version 3 of the License, or
* (at your option) any later version.
*
* Bowtie 2 is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* GNU General Public License for more details.
*
* You should have received a copy of the GNU General Public License
* along with Bowtie 2. If not, see <http://www.gnu.org/licenses/>.
*/
#ifndef ALIGNER_SEED2_H_
#define ALIGNER_SEED2_H_
/**
* The user of the DescentDriver class specifies a collection of search roots.
* Logic for picking these search roots is located elsewhere, not in this
* module. The search roots are annotated with a priority score, which
*
* The heap is a min-heap over pairs, where the first element of each pair is
* the score associated with a descent and the second element of each pair is
* the descent ID.
*
* Weeding out redundant descents is key; otherwise we end up reporting slight
* variations on the same alignment repeatedly, including variations with poor
* scores. What criteria do we use to determine whether two paths are
* redundant?
*
* Here's an example where the same set of read characters have been aligned in
* all three cases:
*
* Alignment 1 (sc = 0):
* Rd: GCTATATAGCGCGCTCGCATCATTTTGTGT
* ||||||||||||||||||||||||||||||
* Rf: GCTATATAGCGCGCTCGCATCATTTTGTGT
*
* Alignment 2 (sc = -22):
* Rd: GCTATATAGCGCGCTCGCATCATTTTGTGT
* ||||||||||||||||||||||| | |||
* Rf: GCTATATAGCGCGCTCGCATCAT--TTTGT
*
* Alignment 3 (sc = -22):
* Rd: GCTATATAGCGCGCTCGCATCATT--TTGTGT
* |||||||||||||||||||||||| |||||
* Rf: GCTATATAGCGCGCTCGCATCATTTTGTGTGT
*
* Rf from aln 1: GCTATATAGCGCGCTCGCATCATTTTGTGT
* Rf from aln 2: GCTATATAGCGCGCTCGCATCATTTTGT
* Rf from aln 3: GCTATATAGCGCGCTCGCATCATTTTGTGTGT
*
* Are alignments 2 and 3 redundant with alignment 1? We can't totally say
* without knowing the associated SA ranges. Take alignments 1 and 2. Either
* the SA ranges are the same or the SA range for 2 contains the SA range for
* 1. If they're the same, then alignment 2 is redundant with alignment 1.
* Otherwise, *some* of the elements in the SA range for alignment 2 are not
* redundant.
*
* In that example, the same read characters are aligned in all three
* alignments. Is it possible and profitable to consider scenarios where an
* alignment might be redundant with another alignment
*
* Another question is *when* do we try to detect the redundancy? Before we
* try to extend through the matches, or after. After is easier, but less work
* has been avoided.
*
* What data structure do we query to determine whether there's redundancy?
* The situation is harder when we try to detect overlaps between SA ranges
* rather than identical SA ranges. Maybe: read intervals -> intersection tree -> penalties.
*
* 1. If we're introducing a gap and we could have introduced it deeper in the
* descent with the same effect w/r/t homopolymer length.
* 2. If we have Descent A with penalty B and Descent a with penalty b, and A
* aligns read characters [X, Y] to SA range [Z, W], and B aligns read
* characters [x, y] to SA range [z, w], then A is redundant with B if
* [x, y] is within [X, Y].
*
* Found an alignment with total penalty = 3
* GCAATATAGCGCGCTCGCATCATTTTGTGT
* || |||||||||||||||||||||||||||
* GCTATATAGCGCGCTCGCATCATTTTGTGT
*
* Found an alignment with total penalty = 27
* gCAATATAGCGCGCTCGCATCATTTTGTGT
* | ||||||||||||||||||||||||
* TATA-TAGCGCGCTCGCATCATTTTGTGT
*/
#include <stdint.h>
#include <math.h>
#include <utility>
#include <limits>
#include "assert_helpers.h"
#include "random_util.h"
#include "aligner_result.h"
#include "gfm.h"
#include "simple_func.h"
#include "scoring.h"
#include "edit.h"
#include "read.h"
#include "ds.h"
#include "group_walk.h"
#include "btypes.h"
typedef size_t TReadOff;
typedef int64_t TScore;
typedef float TRootPri;
typedef size_t TDescentId;
typedef size_t TRootId;
/**
* enum encapsulating a few different policies for how we might extend descents
* in the direction opposite from their primary direction.
*/
enum {
// Never extened in the direction opposite from the primary. Just go in
// the primary direction until the bounce.
DESC_EX_NONE = 1,
// When we're finished extending out the matches for a descent, try to
// extend in the opposite direction in a way that extends all branches
// simultaneously. The Descent.nex_ field contains the number of positions
// we were able to extend through in this way.
DESC_EX_FROM_1ST_BRANCH = 2,
// Each time we add an edge to the summary, extend it in the opposite
// direction. The DescentEdge.nex field contains the number of positions
// we were able to extend through, and this in turn gets propagated to
// Descent.nex_ if and when we branch from the DescentEdge.
DESC_EX_EACH_EDGE = 3
};
/**
* Counters to keep track of how much work is being done.
*/
struct DescentMetrics {
DescentMetrics() { reset(); }
void reset() {
bwops = bwops_1 = bwops_bi = recalc = branch = branch_mm =
branch_del = branch_ins = heap_max = descent_max = descentpos_max =
nex = 0;
}
uint64_t bwops; // # FM Index opbs
uint64_t bwops_1; // # LF1 FM Index opbs
uint64_t bwops_bi; // # BiEx FM Index opbs
uint64_t recalc; // # times outgoing edge summary was recalculated
uint64_t branch; // # times we descended from another descent
uint64_t branch_mm; // # times branch was on a mismatch
uint64_t branch_del; // # times branch was on a deletion
uint64_t branch_ins; // # times branch was on a insertion
uint64_t heap_max; // maximum size of Descent heap
uint64_t descent_max; // maximum size of Descent factory
uint64_t descentpos_max; // maximum size of DescentPos factory
uint64_t nex; // # extensions
};
/**
* Priority used to rank which descent we should branch from next. Right now,
* priority is governed by a 4-tuple. From higher to lower priority:
*
* 1. Penalty accumulated so far
* 2. Depth into the search space, including extensions
* 3. Width of the SA range (i.e. uniqueness)
* 4. Root priority
*/
struct DescentPriority {
DescentPriority() { reset(); }
DescentPriority(
TScore pen_,
size_t depth_,
TIndexOffU width_,
float rootpri_)
{
pen = pen_;
depth = depth_;
width = width_;
rootpri = rootpri_;
}
/**
* Initialize new DescentPriority.
*/
void init(TScore pen_, size_t depth_, TIndexOffU width_, float rootpri_) {
pen = pen_;
depth = depth_;
width = width_;
rootpri = rootpri_;
}
/**
* Reset to uninitialized state.
*/
void reset() {
width = 0;
}
/**
* Return true iff DescentPriority is initialized.
*/
bool inited() const {
return width > 0;
}
/**
* Return true iff this priority is prior to given priority.
*/
bool operator<(const DescentPriority& o) const {
assert(inited());
assert(o.inited());
// 1st priority: penalty accumulated so far
if(pen < o.pen) return true;
if(pen > o.pen) return false;
// 2nd priority: depth into the search space, including extensions
if(depth > o.depth) return true;
if(depth < o.depth) return false;
// 3rd priority: width of the SA range (i.e. uniqueness)
if(width < o.width) return true;
if(width > o.width) return false;
// 4th priority: root priority
if(rootpri > o.rootpri) return true;
return false;
}
/**
* Return true iff this priority is prior to or equal to given priority.
*/
bool operator<=(const DescentPriority& o) const {
assert(inited());
assert(o.inited());
// 1st priority: penalty accumulated so far
if(pen < o.pen) return true;
if(pen > o.pen) return false;
// 2nd priority: depth into the search space, including extensions
if(depth > o.depth) return true;
if(depth < o.depth) return false;
// 3rd priority: width of the SA range (i.e. uniqueness)
if(width < o.depth) return true;
if(width > o.width) return false;
// 4th priority: root priority
if(rootpri > o.rootpri) return true;
return true;
}
/**
* Return true iff this priority is prior to or equal to given priority.
*/
bool operator==(const DescentPriority& o) const {
assert(inited());
assert(o.inited());
return pen == o.pen && depth == o.depth && width == o.width && rootpri == o.rootpri;
}
TScore pen; // total penalty accumulated so far
size_t depth; // depth from root of descent
TIndexOffU width; // width of the SA range
float rootpri; // priority of the root
};
static inline std::ostream& operator<<(
std::ostream& os,
const DescentPriority& o)
{
os << "[" << o.pen << ", " << o.depth << ", " << o.width << ", " << o.rootpri << "]";
return os;
}
static inline std::ostream& operator<<(
std::ostream& os,
const std::pair<DescentPriority, TDescentId>& o)
{
os << "{[" << o.first.pen << ", " << o.first.depth << ", "
<< o.first.width << ", " << o.first.rootpri << "], " << o.second << "}";
return os;
}
typedef std::pair<DescentPriority, TDescentId> TDescentPair;
/**
* Encapsulates the constraints limiting which outgoing edges are permitted.
* Specifically, we constrain the total penalty accumulated so far so that some
* outgoing edges will exceed the limit and be pruned. The limit is set
* according to our "depth" into the search, as measured by the number of read
* characters aligned so far. We divide the depth domain into two pieces, a
* piece close to the root, where the penty is constrained to be 0, and the
* remainder, where the maximum penalty is an interpolation between 0 and the
* maximum penalty
*/
struct DescentConstraints {
DescentConstraints() { reset(); }
/**
* Initialize with new constraint function.
*/
DescentConstraints(size_t nzero, double exp) {
init(nzero, exp);
}
/**
* Initialize with given function.
*/
void init(size_t nzero_, double exp_) {
nzero = nzero_ > 0 ? nzero_ : 1;
exp = exp_;
#ifndef NDEBUG
for(size_t i = 1; i < nzero_ + 5; i++) {
assert_geq(get(i, nzero_ + 10, 100), get(i-1, nzero_ + 10, 100));
}
#endif
}
/**
* Reset to uninitialized state.
*/
void reset() {
nzero = 0;
exp = -1.0f;
}
/**
* Return true iff the DescentConstraints has been initialized.
*/
bool inited() const {
return exp >= 0.0f;
}
/**
* Get the maximum penalty total for depth 'off'.
*/
inline TScore get(TReadOff off, TReadOff rdlen, TAlScore maxpen) const {
if(off < nzero || nzero >= rdlen) {
return 0;
}
double frac = (double)(off - nzero) / (rdlen - nzero);
if(fabs(exp - 1.0f) > 0.00001) {
if(fabs(exp - 2.0f) < 0.00001) {
frac *= frac;
} else {
frac = pow(frac, exp);
}
}
return (TAlScore)(frac * maxpen + 0.5f);
}
size_t nzero;
double exp;
};
/**
* Encapsulates settings governing how we descent.
*/
struct DescentConfig {
DescentConfig() { reset(); }
/**
* Reset the DescentConfig to an uninitialized state.
*/
void reset() { expol = 0; }
/**
* Return true iff this DescentConfig is initialized.
*/
bool inited() const { return expol != 0; }
DescentConstraints cons; // constraints
int expol; // extend policy
};
/**
* Encapsulates the state of a Descent that allows us to determine whether it
* is redundant with another Descent. Two Descents are redundant if:
*
* 1. Both are aligning the same read orientation (fw or rc)
* 2. Both are growing the alignment in the same direction (left-to-right or
* right-to-left)
* 3. They have aligned exactly the same read characters (which are always
* consecutive in the read)
* 4. The corresponding reference strings are identical
*/
struct DescentRedundancyKey {
DescentRedundancyKey() { reset(); }
DescentRedundancyKey(
TReadOff al5pf_,
size_t rflen_,
TIndexOffU topf_,
TIndexOffU botf_)
{
init(al5pf_, rflen_, topf_, botf_);
}
void reset() {
al5pf = 0;
rflen = 0;
topf = botf = 0;
}
bool inited() const { return rflen > 0; }
void init(
TReadOff al5pf_,
size_t rflen_,
TIndexOffU topf_,
TIndexOffU botf_)
{
al5pf = al5pf_;
rflen = rflen_;
topf = topf_;
botf = botf_;
}
bool operator==(const DescentRedundancyKey& o) const {
return al5pf == o.al5pf && rflen == o.rflen && topf == o.topf && botf == o.botf;
}
bool operator<(const DescentRedundancyKey& o) const {
if(al5pf < o.al5pf) return true;
if(al5pf > o.al5pf) return false;
if(rflen < o.rflen) return true;
if(rflen > o.rflen) return false;
if(topf < o.topf) return true;
if(topf > o.topf) return false;
return botf < o.botf;
}
TReadOff al5pf; // 3'-most aligned char, as offset from 5' end
size_t rflen; // number of reference characters involved in alignment
TIndexOffU topf; // top w/r/t forward index
TIndexOffU botf; // bot w/r/t forward index
};
/**
* Map from pairs to top, bot, penalty triples.
*/
class DescentRedundancyChecker {
public:
DescentRedundancyChecker() { reset(); }
void clear() { reset(); }
/**
* Reset to uninitialized state.
*/
void reset() {
bits_.reset();
inited_ = false;
totsz_ = 0; // total size
totcap_ = 0; // total capacity
}
const static int NPARTS = 8;
const static int PART_MASK = 7;
const static int NBITS = (1 << 16);
/**
* Initialize using given read length.
*/
void init(TReadOff rdlen) {
reset();
// daehwan - for debugging purposes
#if 0
bits_.resize(NBITS);
maplist_fl_.resize(NPARTS);
maplist_fr_.resize(NPARTS);
maplist_rl_.resize(NPARTS);
maplist_rr_.resize(NPARTS);
for(int i = 0; i < NPARTS; i++) {
maplist_fl_[i].resize(rdlen);
maplist_fr_[i].resize(rdlen);
maplist_rl_[i].resize(rdlen);
maplist_rr_[i].resize(rdlen);
totcap_ += maplist_fl_[i].totalCapacityBytes();
totcap_ += maplist_fr_[i].totalCapacityBytes();
totcap_ += maplist_rl_[i].totalCapacityBytes();
totcap_ += maplist_rr_[i].totalCapacityBytes();
for(size_t j = 0; j < rdlen; j++) {
maplist_fl_[i][j].clear();
maplist_fr_[i][j].clear();
maplist_rl_[i][j].clear();
maplist_rr_[i][j].clear();
totcap_ += maplist_fl_[i][j].totalCapacityBytes();
totcap_ += maplist_fr_[i][j].totalCapacityBytes();
totcap_ += maplist_rl_[i][j].totalCapacityBytes();
totcap_ += maplist_rr_[i][j].totalCapacityBytes();
}
}
#endif
inited_ = true;
}
/**
* Return true iff the checker is initialized.
*/
bool inited() const {
return inited_;
}
/**
* Check if this partial alignment is redundant with one that we've already
* explored.
*/
bool check(
bool fw,
bool l2r,
TReadOff al5pi,
TReadOff al5pf,
size_t rflen,
TIndexOffU topf,
TIndexOffU botf,
TScore pen)
{
// daehwan - for debugging purposes
return true;
assert(inited_);
assert(topf > 0 || botf > 0);
DescentRedundancyKey k(al5pf, rflen, topf, botf);
size_t i = std::numeric_limits<size_t>::max();
size_t mask = topf & PART_MASK;
EMap<DescentRedundancyKey, TScore>& map =
(fw ? (l2r ? maplist_fl_[mask][al5pi] : maplist_fr_[mask][al5pi]) :
(l2r ? maplist_rl_[mask][al5pi] : maplist_rr_[mask][al5pi]));
size_t key = (topf & 255) | ((botf & 255) << 8);
if(bits_.test(key) && map.containsEx(k, i)) {
// Already contains the key
assert_lt(i, map.size());
assert_geq(pen, map[i].second);
return false;
}
assert(!map.containsEx(k, i));
size_t oldsz = map.totalSizeBytes();
size_t oldcap = map.totalCapacityBytes();
map.insert(make_pair(k, pen));
bits_.set(key);
totsz_ += (map.totalSizeBytes() - oldsz);
totcap_ += (map.totalCapacityBytes() - oldcap);
return true;
}
/**
* Check if this partial alignment is redundant with one that we've already
* explored using the Bw index SA range.
*/
bool contains(
bool fw,
bool l2r,
TReadOff al5pi,
TReadOff al5pf,
size_t rflen,
TIndexOffU topf,
TIndexOffU botf,
TScore pen)
{
// daehwan - for debugging purposes
return false;
assert(inited_);
size_t key = (topf & 255) | ((botf & 255) << 8);
if(!bits_.test(key)) {
return false;
}
DescentRedundancyKey k(al5pf, rflen, topf, botf);
size_t mask = topf & PART_MASK;
EMap<DescentRedundancyKey, TScore>& map =
(fw ? (l2r ? maplist_fl_[mask][al5pi] : maplist_fr_[mask][al5pi]) :
(l2r ? maplist_rl_[mask][al5pi] : maplist_rr_[mask][al5pi]));
return map.contains(k);
}
/**
* Return the total size of the redundancy map.
*/
size_t totalSizeBytes() const {
return totsz_;
}
/**
* Return the total capacity of the redundancy map.
*/
size_t totalCapacityBytes() const {
return totcap_;
}
protected:
bool inited_; // initialized?
size_t totsz_; // total size
size_t totcap_; // total capacity
// List of maps. Each entry is a map for all the DescentRedundancyKeys
// with al5pi equal to the offset into the list.
ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_fl_; // fw, l2r
ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_rl_; // !fw, l2r
ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_fr_; // fw, !l2r
ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_rr_; // !fw, !l2r
EBitList<128> bits_;
};
/**
* A search root. Consists of an offset from the 5' end read and flags
* indicating (a) whether we're initially heading left-to-right or
* right-to-left, and (b) whether we're examining the read or its reverse
* complement.
*
* A root also comes with a priority ("pri") score indicating how promising it
* is as a root. Promising roots have long stretches of high-quality,
* non-repetitive nucleotides in the first several ply of the search tree.
* Also, roots beginning at the 5' end of the read may receive a higher
* priority.
*/
struct DescentRoot {
DescentRoot() { reset(); }
DescentRoot(size_t off5p_, bool l2r_, bool fw_, size_t len, float pri_) {
init(off5p_, l2r_, fw_, len, pri_);
}
/**
* Reset this DescentRoot to uninitialized state.
*/
void reset() {
off5p = std::numeric_limits<size_t>::max();
}
/**
* Return true iff this DescentRoot is uninitialized.
*/
bool inited() const {
return off5p == std::numeric_limits<size_t>::max();
}
/**
* Initialize a new descent root.
*/
void init(size_t off5p_, bool l2r_, bool fw_, size_t len, float pri_) {
off5p = off5p_;
l2r = l2r_;
fw = fw_;
pri = pri_;
assert_lt(off5p, len);
}
TReadOff off5p; // root origin offset, expressed as offset from 5' end
bool l2r; // true -> move in left-to-right direction
bool fw; // true -> work with forward read, false -> revcomp
float pri; // priority of seed
};
/**
* Set of flags indicating outgoing edges we've tried from a DescentPos.
*/
struct DescentPosFlags {
DescentPosFlags() { reset(); }
/**
* Set all flags to 1, indicating all outgoing edges are yet to be
* explored.
*/
void reset() {
mm_a = mm_c = mm_g = mm_t = rdg_a = rdg_c = rdg_g = rdg_t = rfg = 1;
reserved = 0;
}
/**
* Return true iff all outgoing edges have already been explored.
*/
bool exhausted() const {
return ((uint16_t*)this)[0] == 0;
}
/**
* Return false iff the specified mismatch has already been explored.
*/
bool mmExplore(int c) {
assert_range(0, 3, c);
if(c == 0) {
return mm_a;
} else if(c == 1) {
return mm_c;
} else if(c == 2) {
return mm_g;
} else {
return mm_t;
}
}
/**
* Try to explore a mismatch. Return false iff it has already been
* explored.
*/
bool mmSet(int c) {
assert_range(0, 3, c);
if(c == 0) {
bool ret = mm_a; mm_a = 0; return ret;
} else if(c == 1) {
bool ret = mm_c; mm_c = 0; return ret;
} else if(c == 2) {
bool ret = mm_g; mm_g = 0; return ret;
} else {
bool ret = mm_t; mm_t = 0; return ret;
}
}
/**
* Return false iff specified read gap has already been explored.
*/
bool rdgExplore(int c) {
assert_range(0, 3, c);
if(c == 0) {
return rdg_a;
} else if(c == 1) {
return rdg_c;
} else if(c == 2) {
return rdg_g;
} else {
return rdg_t;
}
}
/**
* Try to explore a read gap. Return false iff it has already been
* explored.
*/
bool rdgSet(int c) {
assert_range(0, 3, c);
if(c == 0) {
bool ret = rdg_a; rdg_a = 0; return ret;
} else if(c == 1) {
bool ret = rdg_c; rdg_c = 0; return ret;
} else if(c == 2) {
bool ret = rdg_g; rdg_g = 0; return ret;
} else {
bool ret = rdg_t; rdg_t = 0; return ret;
}
}
/**
* Return false iff the reference gap has already been explored.
*/
bool rfgExplore() {
return rfg;
}
/**
* Try to explore a reference gap. Return false iff it has already been
* explored.
*/
bool rfgSet() {
bool ret = rfg; rfg = 0; return ret;
}
uint16_t mm_a : 1;
uint16_t mm_c : 1;
uint16_t mm_g : 1;
uint16_t mm_t : 1;
uint16_t rdg_a : 1;
uint16_t rdg_c : 1;
uint16_t rdg_g : 1;
uint16_t rdg_t : 1;
uint16_t rfg : 1;
uint16_t reserved : 7;
};
/**
* FM Index state associated with a single position in a descent. For both the
* forward and backward indexes, it stores the four SA ranges corresponding to
* the four nucleotides.
*/
struct DescentPos {
/**
* Reset all tops and bots to 0.
*/
void reset() {
topf[0] = topf[1] = topf[2] = topf[3] = 0;
botf[0] = botf[1] = botf[2] = botf[3] = 0;
topb[0] = topb[1] = topb[2] = topb[3] = 0;
botb[0] = botb[1] = botb[2] = botb[3] = 0;
c = -1;
flags.reset();
}
/**
* Return true iff DescentPos has been initialized.
*/
bool inited() const {
return c >= 0;
}
#ifndef NDEBUG
/**
* Check that DescentPos is internally consistent.
*/
bool repOk() const {
assert_range(0, 3, (int)c);
return true;
}
#endif
TIndexOffU topf[4]; // SA range top indexes in fw index
TIndexOffU botf[4]; // SA range bottom indexes (exclusive) in fw index
TIndexOffU topb[4]; // SA range top indexes in bw index
TIndexOffU botb[4]; // SA range bottom indexes (exclusive) in bw index
char c; // read char that would yield match
DescentPosFlags flags; // flags
};
/**
* Encapsulates an edge outgoing from a descent.
*/
struct DescentEdge {
DescentEdge() { reset(); }
DescentEdge(
Edit e_,
TReadOff off5p_,
DescentPriority pri_,
size_t posFlag_,
TReadOff nex_
#ifndef NDEBUG
,
size_t d_,
TIndexOffU topf_,
TIndexOffU botf_,
TIndexOffU topb_,
TIndexOffU botb_
#endif
)
{
init(e_, off5p_, pri_, posFlag_
#ifndef NDEBUG
, d_, topf_, botf_, topb_, botb_
#endif
);
}
/**
* Return true iff edge is initialized.
*/
bool inited() const { return e.inited(); }
/**
* Reset to uninitialized state.
*/
void reset() { e.reset(); }
/**
* Initialize DescentEdge given 5' offset, nucleotide, and priority.
*/
void init(
Edit e_,
TReadOff off5p_,
DescentPriority pri_,
size_t posFlag_
#ifndef NDEBUG
,
size_t d_,
TIndexOffU topf_,
TIndexOffU botf_,
TIndexOffU topb_,
TIndexOffU botb_
#endif
)
{
e = e_;
off5p = off5p_;
pri = pri_;
posFlag = posFlag_;
#ifndef NDEBUG
d = d_;
topf = topf_;
botf = botf_;
topb = topb_;
botb = botb_;
#endif
}
/**
* Update flags to show this edge as visited.
*/
void updateFlags(EFactory<DescentPos>& pf) {
if(inited()) {
if(e.isReadGap()) {
assert_neq('-', e.chr);
pf[posFlag].flags.rdgSet(asc2dna[e.chr]);
} else if(e.isRefGap()) {
pf[posFlag].flags.rfgSet();
} else {
assert_neq('-', e.chr);
pf[posFlag].flags.mmSet(asc2dna[e.chr]);
}
}
}
/**
* Return true iff this edge has higher priority than the given edge.
*/
bool operator<(const DescentEdge& o) const {
if(inited() && !o.inited()) {
return true;
} else if(!inited()) {
return false;
}
return pri < o.pri;
}
DescentPriority pri; // priority of the edge
//TReadOff nex; // # extends possible from this edge
size_t posFlag; // depth of DescentPos where flag should be set
#ifndef NDEBUG
// This can be recreated by looking at the edit, the paren't descent's
// len_, al5pi_, al5pf_. I have it here so we can sanity check.
size_t d;
TIndexOffU topf, botf, topb, botb;
#endif
Edit e;
TReadOff off5p;
};
/**
* Encapsulates an incomplete summary of the outgoing edges from a descent. We
* don't try to store information about all outgoing edges, because doing so
* will generally be wasteful. We'll typically only try a handful of them per
* descent.
*/
class DescentOutgoing {
public:
/**
* Return the best edge and rotate in preparation for next call.
*/
DescentEdge rotate() {
DescentEdge tmp = best1;
assert(!(best2 < tmp));
best1 = best2;
assert(!(best3 < best2));
best2 = best3;
assert(!(best4 < best3));
best3 = best4;
assert(!(best5 < best4));
best4 = best5;
best5.reset();
return tmp;
}
/**
* Given a potental outgoing edge, place it where it belongs in the running
* list of best 5 outgoing edges from this descent.
*/
void update(DescentEdge e) {
if(!best1.inited()) {
best1 = e;
} else if(e < best1) {
best5 = best4;
best4 = best3;
best3 = best2;
best2 = best1;
best1 = e;
} else if(!best2.inited()) {
best2 = e;
} else if(e < best2) {
best5 = best4;
best4 = best3;
best3 = best2;
best2 = e;
} else if(!best3.inited()) {
best3 = e;
} else if(e < best3) {
best5 = best4;
best4 = best3;
best3 = e;
} else if(!best4.inited()) {
best4 = e;
} else if(e < best4) {
best5 = best4;
best4 = e;
} else if(!best5.inited() || e < best5) {
best5 = e;
}
}
/**
* Clear all the outgoing edges stored here.
*/
void clear() {
best1.reset();
best2.reset();
best3.reset();
best4.reset();
best5.reset();
}
/**
* Return true iff there are no outgoing edges currently represented in
* this summary. There may still be outgoing edges, they just haven't
* been added to the summary.
*/
bool empty() const {
return !best1.inited();
}
/**
* Return the DescentPriority of the best outgoing edge.
*/
DescentPriority bestPri() const {
assert(!empty());
return best1.pri;
}
DescentEdge best1; // best
DescentEdge best2; // 2nd-best
DescentEdge best3; // 3rd-best
DescentEdge best4; // 4th-best
DescentEdge best5; // 5th-best
};
template <typename index_t>
class DescentAlignmentSink;
/**
* Encapsulates a descent through a search tree, along a path of matches.
* Descents that are part of the same alignment form a chain. Two aligments
* adjacent in the chain are connected either by an edit, or by a switch in
* direction. Because a descent might have a different direction from the
* DescentRoot it ultimately came from, it has its own 'l2r' field, which might
* differ from the root's.
*/
template <typename index_t>
class Descent {
public:
Descent() { reset(); }
/**
* Initialize a new descent branching from the given descent via the given
* edit. Return false if the Descent has no outgoing edges (and can
* therefore have its memory freed), true otherwise.
*/
bool init(
const Read& q, // query
TRootId rid, // root id
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
TReadOff al5pi, // offset from 5' of 1st aligned char
TReadOff al5pf, // offset from 5' of last aligned char
TIndexOffU topf, // SA range top in FW index
TIndexOffU botf, // SA range bottom in FW index
TIndexOffU topb, // SA range top in BW index
TIndexOffU botb, // SA range bottom in BW index
bool l2r, // direction this descent will go in
size_t descid, // my ID
TDescentId parent, // parent ID
TScore pen, // total penalties so far
const Edit& e, // edit for incoming edge
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent>& df, // Descent factory
EFactory<DescentPos>& pf, // DescentPos factory
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm); // per-read metrics
/**
* Initialize a new descent beginning at the given root. Return false if
* the Descent has no outgoing edges (and can therefore have its memory
* freed), true otherwise.
*/
bool init(
const Read& q, // query
TRootId rid, // root id
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
size_t descid, // id of this Descent
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent>& df, // Descent factory
EFactory<DescentPos>& pf, // DescentPos factory
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm); // per-read metrics
/**
* Return true iff this Descent has been initialized.
*/
bool inited() const {
return descid_ != std::numeric_limits<size_t>::max();
}
/**
* Reset to uninitialized state.
*/
void reset() {
lastRecalc_ = true;
descid_ = std::numeric_limits<size_t>::max();
}
/**
* Return true iff this Descent is a search root.
*/
bool root() const {
return parent_ == std::numeric_limits<TDescentId>::max();
}
/**
* Return the edit.
*/
const Edit& edit() const {
return edit_;
}
/**
* Return id of parent.
*/
TDescentId parent() const {
return parent_;
}
/**
* Take the best outgoing edge and follow it.
*/
void followBestOutgoing(
const Read& q, // read
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent>& df, // factory with Descent
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap of descents
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm); // per-read metrics
/**
* Return true iff no outgoing edges from this descent remain unexplored.
*/
bool empty() const { return lastRecalc_ && out_.empty(); }
#ifndef NDEBUG
/**
* Return true iff the Descent is internally consistent.
*/
bool repOk(const Read *q) const {
// A non-root can have an uninitialized edit_ if it is from a bounce
//assert( root() || edit_.inited());
assert(!root() || !edit_.inited());
assert_eq(botf_ - topf_, botb_ - topb_);
if(q != NULL) {
assert_leq(len_, q->length());
}
return true;
}
#endif
size_t al5pi() const { return al5pi_; }
size_t al5pf() const { return al5pf_; }
bool l2r() const { return l2r_; }
/**
* Print a stacked representation of this descent and all its parents. Assumes that
*/
void print(
std::ostream* os,
const char *prefix,
const Read& q,
size_t trimLf,
size_t trimRg,
bool fw,
const EList<Edit>& edits,
size_t ei,
size_t en,
BTDnaString& rf) const;
/**
* Collect all the edits
*/
void collectEdits(
EList<Edit>& edits,
const Edit *e,
EFactory<Descent>& df)
{
// Take just the portion of the read that has aligned up until this
// point
size_t nuninited = 0;
size_t ei = edits.size();
size_t en = 0;
if(e != NULL && e->inited()) {
edits.push_back(*e);
en++;
}
size_t cur = descid_;
while(cur != std::numeric_limits<TDescentId>::max()) {
if(!df[cur].edit().inited()) {
nuninited++;
assert_leq(nuninited, 2);
} else {
edits.push_back(df[cur].edit());
en++;
}
cur = df[cur].parent();
}
// Sort just the edits we just added
edits.sortPortion(ei, en);
}
protected:
/**
*
*/
bool bounce(
const Read& q, // query string
TIndexOffU topf, // SA range top in fw index
TIndexOffU botf, // SA range bottom in fw index
TIndexOffU topb, // SA range top in bw index
TIndexOffU botb, // SA range bottom in bw index
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent>& df, // factory with Descent
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap of descents
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm); // per-read metrics
/**
* Given the forward and backward indexes, and given topf/botf/topb/botb,
* get tloc, bloc ready for the next step.
*/
void nextLocsBi(
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
SideLocus<index_t>& tloc, // top locus
SideLocus<index_t>& bloc, // bot locus
index_t topf, // top in BWT
index_t botf, // bot in BWT
index_t topb, // top in BWT'
index_t botb); // bot in BWT'
/**
* Advance this descent by following read matches as far as possible.
*/
bool followMatches(
const Read& q, // query string
const Scoring& sc, // scoring scheme
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent>& df, // Descent factory
EFactory<DescentPos>& pf, // DescentPos factory
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm, // per-read metrics
bool& branches, // out: true -> there are > 0 ways to branch
bool& hitEnd, // out: true -> hit read end with non-empty range
bool& done, // out: true -> we made a full alignment
TReadOff& off5p_i, // out: initial 5' offset
TIndexOffU& topf_bounce, // out: top of SA range for fw idx for bounce
TIndexOffU& botf_bounce, // out: bot of SA range for fw idx for bounce
TIndexOffU& topb_bounce, // out: top of SA range for bw idx for bounce
TIndexOffU& botb_bounce); // out: bot of SA range for bw idx for bounce
/**
* Recalculate our summary of the outgoing edges from this descent. When
* deciding what outgoing edges are legal, we abide by constraints.
* Typically, they limit the total of the penalties accumulated so far, as
* a function of distance from the search root. E.g. a constraint might
* disallow any gaps or mismatches within 20 ply of the search root, then
* allow 1 mismatch within 30 ply, then allow up to 1 mismatch or 1 gap
* within 40 ply, etc.
*/
size_t recalcOutgoing(
const Read& q, // query string
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
DescentRedundancyChecker& re, // redundancy checker
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
PerReadMetrics& prm); // per-read metrics
TRootId rid_; // root id
TReadOff al5pi_; // lo offset from 5' end of aligned read char
TReadOff al5pf_; // hi offset from 5' end of aligned read char
bool l2r_; // left-to-right?
int gapadd_; // net ref characters additional
TReadOff off5p_i_; // offset we started out at for this descent
TIndexOffU topf_, botf_; // incoming SA range w/r/t forward index
TIndexOffU topb_, botb_; // incoming SA range w/r/t forward index
size_t descid_; // ID of this descent
TDescentId parent_; // ID of parent descent
TScore pen_; // total penalties accumulated so far
size_t posid_; // ID of 1st elt of the DescentPos factory w/
// descent pos info for this descent
size_t len_; // length of stretch of matches
DescentOutgoing out_; // summary of outgoing edges
Edit edit_; // edit joining this descent with parent
bool lastRecalc_; // set by recalcOutgoing if out edges empty
};
/**
* An alignment result from a Descent.
*/
struct DescentAlignment {
DescentAlignment() { reset(); }
/**
* Reset DescentAlignment to be uninitialized.
*/
void reset() {
topf = botf = 0;
pen = 0;
fw = false;
ei = en = 0;
}
/**
* Initialize this DescentAlignment.
*/
void init(
TScore pen_,
bool fw_,
TIndexOffU topf_,
TIndexOffU botf_,
size_t ei_,
size_t en_)
{
assert_gt(botf_, topf_);
pen = pen_;
fw = fw_;
topf = topf_;
botf = botf_;
ei = ei_;
en = en_;
}
/**
* Return true iff DescentAlignment is initialized.
*/
bool inited() const {
return botf > topf;
}
/**
* Return true iff the alignment is perfect (has no edits)
*/
bool perfect() const {
return pen == 0;
}
/**
* Return the number of elements in this range.
*/
size_t size() const {
return botf - topf;
}
TScore pen; // score
bool fw; // forward or revcomp aligned?
TIndexOffU topf; // top in forward index
TIndexOffU botf; // bot in forward index
size_t ei; // First edit in DescentAlignmentSink::edits_ involved in aln
size_t en; // # edits in DescentAlignmentSink::edits_ involved in aln
};
/**
* A partial alignment result from a Descent where the reference offset has
* been resolved.
*/
struct DescentPartialResolvedAlignment {
DescentPartialResolvedAlignment() { reset(); }
/**
* Reset DescentAlignment to be uninitialized.
*/
void reset() {
topf = botf = 0;
pen = 0;
fw = false;
ei = en = 0;
refcoord.reset();
}
/**
* Initialize this DescentAlignment.
*/
void init(
TScore pen_,
bool fw_,
TIndexOffU topf_,
TIndexOffU botf_,
size_t ei_,
size_t en_,
const Coord& refcoord_)
{
assert_gt(botf_, topf_);
pen = pen_;
fw = fw_;
topf = topf_;
botf = botf_;
ei = ei_;
en = en_;
refcoord = refcoord_;
}
/**
* Return true iff DescentAlignment is initialized.
*/
bool inited() const {
return botf > topf;
}
/**
* Return the number of elements in this range.
*/
size_t size() const {
return botf - topf;
}
TScore pen; // score
bool fw; // forward or revcomp aligned?
TIndexOffU topf; // top in forward index
TIndexOffU botf; // bot in forward index
size_t ei; // First edit in DescentAlignmentSink::edits_ involved in aln
size_t en; // # edits in DescentAlignmentSink::edits_ involved in aln
Coord refcoord; // reference coord of leftmost ref char involved
};
/**
* Class that accepts alignments found during descent and maintains the state
* required to dispense them to consumers in an appropriate order.
*
* As for order in which they are dispensed, in order to maintain uniform
* distribution over equal-scoring alignments, a good policy may be not to
* dispense alignments at a given score stratum until *all* alignments at that
* stratum have been accumulated (i.e. until our best-first search has moved on
* to a worse stratum). This also has the advantage that, for each alignment,
* we can also report the number of other alignments in that cost stratum.
*
* A lazier alternative is to assume that the order in which alignments in a
* given stratum arrive is already pseudo-random, which frees us from having to
* wait until the entire stratum has been explored. But there is reason to
* think that this order is not truly pseudo-random, since our root placement
* and root priorities will tend to first lead us to alignments with certain
* patterns of edits.
*/
template <typename index_t>
class DescentAlignmentSink {
public:
/**
* If this is the final descent in a complete end-to-end alignment, report
* the alignment.
*/
bool reportAlignment(
const Read& q, // query string
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
TIndexOffU topf, // SA range top in forward index
TIndexOffU botf, // SA range bottom in forward index
TIndexOffU topb, // SA range top in backward index
TIndexOffU botb, // SA range bottom in backward index
TDescentId id, // id of leaf Descent
TRootId rid, // id of search root
const Edit& e, // final edit, if needed
TScore pen, // total penalty
EFactory<Descent<index_t> >& df, // factory with Descent
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs); // configs
/**
* Reset to uninitialized state.
*/
void reset() {
edits_.clear();
als_.clear();
lhs_.clear();
rhs_.clear();
nelt_ = 0;
bestPen_ = worstPen_ = std::numeric_limits<TAlScore>::max();
}
/**
* Return the total size occupued by the Descent driver and all its
* constituent parts.
*/
size_t totalSizeBytes() const {
return edits_.totalSizeBytes() +
als_.totalSizeBytes() +
lhs_.totalSizeBytes() +
rhs_.totalSizeBytes() +
sizeof(size_t);
}
/**
* Return the total capacity of the Descent driver and all its constituent
* parts.
*/
size_t totalCapacityBytes() const {
return edits_.totalCapacityBytes() +
als_.totalCapacityBytes() +
lhs_.totalCapacityBytes() +
rhs_.totalCapacityBytes() +
sizeof(size_t);
}
/**
* Return the number of SA ranges involved in hits.
*/
size_t nrange() const {
return als_.size();
}
/**
* Return the number of SA elements involved in hits.
*/
size_t nelt() const {
return nelt_;
}
/**
* The caller provides 'i', which is an offset of a particular element in
* one of the SA ranges in the current stratum. This function returns, in
* 'al' and 'off', information about the element in terms of the range it's
* part of and its offset into that range.
*/
void elt(size_t i, DescentAlignment& al, size_t& ri, size_t& off) const {
assert_lt(i, nelt());
for(size_t j = 0; j < als_.size(); j++) {
if(i < als_[j].size()) {
al = als_[j];
ri = j;
off = i;
return;
}
i -= als_[j].size();
}
assert(false);
}
/**
* Get a particular alignment.
*/
const DescentAlignment& operator[](size_t i) const {
return als_[i];
}
/**
* Return true iff (a) we found an alignment since the sink was initialized
* or since the last time advanceStratum() was called, and (b) the penalty
* associated with the current-best task on the heap ('best') is worse
* (higher) than the penalty associated with the alignments found most
* recently (worstPen_).
*/
bool stratumDone(TAlScore bestPen) const {
if(nelt_ > 0 && bestPen > worstPen_) {
return true;
}
return false;
}
/**
* The alignment consumer calls this to indicate that they are done with
* all the alignments in the current best non-empty stratum. We can
* therefore mark all those alignments as "reported" and start collecting
* results for the next stratum.
*/
void advanceStratum() {
assert_gt(nelt_, 0);
edits_.clear();
als_.clear();
// Don't reset lhs_ or rhs_
nelt_ = 0;
bestPen_ = worstPen_ = std::numeric_limits<TAlScore>::max();
}
#ifndef NDEBUG
/**
* Check that alignment sink is internally consistent.
*/
bool repOk() const {
assert_geq(nelt_, als_.size());
for(size_t i = 1; i < als_.size(); i++) {
assert_geq(als_[i].pen, als_[i-1].pen);
}
assert(bestPen_ == std::numeric_limits<TAlScore>::max() || worstPen_ >= bestPen_);
return true;
}
#endif
TAlScore bestPenalty() const { return bestPen_; }
TAlScore worstPenalty() const { return worstPen_; }
size_t editsSize() const { return edits_.size(); }
size_t alsSize() const { return als_.size(); }
size_t lhsSize() const { return lhs_.size(); }
size_t rhsSize() const { return rhs_.size(); }
const EList<Edit>& edits() const { return edits_; }
protected:
EList<Edit> edits_;
EList<DescentAlignment> als_;
ESet<Triple<TIndexOffU, TIndexOffU, size_t> > lhs_;
ESet<Triple<TIndexOffU, TIndexOffU, size_t> > rhs_;
size_t nelt_;
TAlScore bestPen_; // best (smallest) penalty among as-yet-unreported alns
TAlScore worstPen_; // worst (greatest) penalty among as-yet-unreported alns
#ifndef NDEBUG
BTDnaString tmprfdnastr_;
#endif
};
/**
* Class that aggregates partial alignments taken from a snapshot of the
* DescentDriver heap.
*/
class DescentPartialResolvedAlignmentSink {
public:
/**
* Reset to uninitialized state.
*/
void reset() {
edits_.clear();
als_.clear();
nelt_ = 0;
bestPen_ = worstPen_ = std::numeric_limits<TAlScore>::max();
}
/**
* Return the total size occupued by the Descent driver and all its
* constituent parts.
*/
size_t totalSizeBytes() const {
return edits_.totalSizeBytes() +
als_.totalSizeBytes() +
sizeof(size_t);
}
/**
* Return the total capacity of the Descent driver and all its constituent
* parts.
*/
size_t totalCapacityBytes() const {
return edits_.totalCapacityBytes() +
als_.totalCapacityBytes() +
sizeof(size_t);
}
/**
* Return the number of SA ranges involved in hits.
*/
size_t nrange() const {
return als_.size();
}
/**
* Return the number of SA elements involved in hits.
*/
size_t nelt() const {
return nelt_;
}
/**
* The caller provides 'i', which is an offset of a particular element in
* one of the SA ranges in the current stratum. This function returns, in
* 'al' and 'off', information about the element in terms of the range it's
* part of and its offset into that range.
*/
void elt(size_t i, DescentPartialResolvedAlignment& al, size_t& ri, size_t& off) const {
assert_lt(i, nelt());
for(size_t j = 0; j < als_.size(); j++) {
if(i < als_[j].size()) {
al = als_[j];
ri = j;
off = i;
return;
}
i -= als_[j].size();
}
assert(false);
}
/**
* Get a particular alignment.
*/
const DescentPartialResolvedAlignment& operator[](size_t i) const {
return als_[i];
}
/**
* Return true iff (a) we found an alignment since the sink was initialized
* or since the last time advanceStratum() was called, and (b) the penalty
* associated with the current-best task on the heap ('best') is worse
* (higher) than the penalty associated with the alignments found most
* recently (worstPen_).
*/
bool stratumDone(TAlScore bestPen) const {
if(nelt_ > 0 && bestPen > worstPen_) {
return true;
}
return false;
}
/**
* The alignment consumer calls this to indicate that they are done with
* all the alignments in the current best non-empty stratum. We can
* therefore mark all those alignments as "reported" and start collecting
* results for the next stratum.
*/
void advanceStratum() {
assert_gt(nelt_, 0);
edits_.clear();
als_.clear();
nelt_ = 0;
bestPen_ = worstPen_ = std::numeric_limits<TAlScore>::max();
}
#ifndef NDEBUG
/**
* Check that partial alignment sink is internally consistent.
*/
bool repOk() const {
assert_geq(nelt_, als_.size());
//for(size_t i = 1; i < als_.size(); i++) {
// assert_geq(als_[i].pen, als_[i-1].pen);
//}
assert(bestPen_ == std::numeric_limits<TAlScore>::max() || worstPen_ >= bestPen_);
return true;
}
#endif
TAlScore bestPenalty() const { return bestPen_; }
TAlScore worstPenalty() const { return worstPen_; }
size_t editsSize() const { return edits_.size(); }
size_t alsSize() const { return als_.size(); }
const EList<Edit>& edits() const { return edits_; }
protected:
EList<Edit> edits_;
EList<DescentPartialResolvedAlignment> als_;
size_t nelt_;
TAlScore bestPen_; // best (smallest) penalty among as-yet-unreported alns
TAlScore worstPen_; // worst (greatest) penalty among as-yet-unreported alns
};
/**
* Abstract parent for classes that select descent roots and descent
* configurations given information about the read.
*/
class DescentRootSelector {
public:
virtual ~DescentRootSelector() { }
virtual void select(
const Read& q, // read that we're selecting roots for
const Read* qo, // opposite mate, if applicable
bool nofw, // don't add roots for fw read
bool norc, // don't add roots for rc read
EList<DescentConfig>& confs, // put DescentConfigs here
EList<DescentRoot>& roots) = 0; // put DescentRoot here
};
/**
* Encapsulates a set of conditions governing when the DescentDriver should
* stop.
*/
struct DescentStoppingConditions {
DescentStoppingConditions() { reset(); }
DescentStoppingConditions(
size_t totsz_,
size_t nfound_,
bool stra_,
size_t nbwop_)
{
init(totsz_, nfound_, stra_, nbwop_);
}
/**
* Reset to uninitialized state.
*/
void reset() {
totsz = nfound = nbwop = std::numeric_limits<size_t>::max();
stra = false;
assert(!inited());
}
/**
* Initialize this DescentStoppingConditions.
*/
void init(
size_t totsz_,
size_t nfound_,
bool stra_,
size_t nbwop_)
{
totsz = totsz_;
nfound = nfound_;
stra = stra_;
nbwop = nbwop_;
assert(inited());
}
/**
* Return true iff this instance is initialized.
*/
bool inited() const {
return totsz != std::numeric_limits<size_t>::max();
}
size_t totsz; // total size of all the expandable data structures in bytes
size_t nfound; // # alignments found
bool stra; // stop after each non-empty stratum
size_t nbwop; // # Burrows-Wheeler (rank) operations performed
};
enum {
DESCENT_DRIVER_ALN = 1,
DESCENT_DRIVER_STRATA = 2,
DESCENT_DRIVER_MEM = 4,
DESCENT_DRIVER_BWOPS = 8,
DESCENT_DRIVER_DONE = 16
};
/**
* Class responsible for advancing all the descents. The initial descents may
* emanate from several different locations in the read. Note that descents
* may become redundant with each other, and should then be eliminated.
*/
template <typename index_t>
class DescentDriver {
public:
DescentDriver(bool veryVerbose) :
veryVerbose_(veryVerbose)
{
reset();
}
/**
* Initialize driver with respect to a new read. If a DescentRootSelector
* is specified, then it is used to obtain roots as well.
*/
void initRead(
const Read& q,
bool nofw,
bool norc,
TAlScore minsc,
TAlScore maxpen,
const Read* qu = NULL,
DescentRootSelector *sel = NULL)
{
reset();
q_ = q;
minsc_ = minsc;
maxpen_ = maxpen;
if(sel != NULL) {
sel->select(q_, qu, nofw, norc, confs_, roots_);
}
re_.init(q.length());
}
/**
* Add a new search root, which might (a) prefer to move in a left-to-right
* direction, and might (b) be with respect to the read or its reverse
* complement.
*/
void addRoot(
const DescentConfig& conf,
TReadOff off,
bool l2r,
bool fw,
float pri)
{
confs_.push_back(conf);
assert_lt(off, q_.length());
if(l2r && off == q_.length()-1) {
l2r = !l2r;
} else if(!l2r && off == 0) {
l2r = !l2r;
}
roots_.push_back(DescentRoot(off, l2r, fw, q_.length(), pri));
}
/**
* Clear out the DescentRoots currently configured.
*/
void clearRoots() {
confs_.clear();
roots_.clear();
}
/**
* Clear the Descent driver so that we're ready to re-start seed alignment
* for the current read.
*/
void resetRead() {
df_.clear(); // clear Descents
assert_leq(df_.totalSizeBytes(), 100);
pf_.clear(); // clear DescentPoss
assert_leq(pf_.totalSizeBytes(), 100);
heap_.clear(); // clear Heap
assert_leq(heap_.totalSizeBytes(), 100);
roots_.clear(); // clear roots
assert_leq(roots_.totalSizeBytes(), 100);
confs_.clear(); // clear confs
assert_leq(confs_.totalSizeBytes(), 100);
alsink_.reset(); // clear alignment sink
assert_leq(alsink_.totalSizeBytes(), 100);
re_.reset();
assert_leq(re_.totalSizeBytes(), 100);
rootsInited_ = 0; // haven't yet created initial descents
curPen_ = 0; //
}
/**
* Clear the Descent driver so that we're ready to re-start seed alignment
* for the current read.
*/
void reset() {
resetRead();
}
/**
* Perform seed alignment.
*/
void go(
const Scoring& sc, // scoring scheme
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentMetrics& met, // metrics
PerReadMetrics& prm); // per-read metrics
/**
* Perform seed alignment until some stopping condition is satisfied.
*/
int advance(
const DescentStoppingConditions& stopc, // stopping conditions
const Scoring& sc, // scoring scheme
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentMetrics& met, // metrics
PerReadMetrics& prm); // per-read metrics
#ifndef NDEBUG
/**
* Return true iff this DescentDriver is well formed. Throw an assertion
* otherwise.
*/
bool repOk() const {
return true;
}
#endif
/**
* Return the number of end-to-end alignments reported.
*/
size_t numAlignments() const {
return alsink_.nelt();
}
/**
* Return the associated DescentAlignmentSink object.
*/
const DescentAlignmentSink<index_t>& sink() const {
return alsink_;
}
/**
* Return the associated DescentAlignmentSink object.
*/
DescentAlignmentSink<index_t>& sink() {
return alsink_;
}
/**
* Return the total size occupued by the Descent driver and all its
* constituent parts.
*/
size_t totalSizeBytes() const {
return df_.totalSizeBytes() +
pf_.totalSizeBytes() +
heap_.totalSizeBytes() +
roots_.totalSizeBytes() +
confs_.totalSizeBytes() +
alsink_.totalSizeBytes() +
re_.totalSizeBytes();
}
/**
* Return the total capacity of the Descent driver and all its constituent
* parts.
*/
size_t totalCapacityBytes() const {
return df_.totalCapacityBytes() +
pf_.totalCapacityBytes() +
heap_.totalCapacityBytes() +
roots_.totalCapacityBytes() +
confs_.totalCapacityBytes() +
alsink_.totalCapacityBytes() +
re_.totalCapacityBytes();
}
/**
* Return a const ref to the query.
*/
const Read& query() const {
return q_;
}
/**
* Return the minimum score that must be achieved by an alignment in order
* for it to be considered "valid".
*/
TAlScore minScore() const {
return minsc_;
}
protected:
Read q_; // query nucleotide and quality strings
TAlScore minsc_; // minimum score
TAlScore maxpen_; // maximum penalty
EFactory<Descent<index_t> > df_; // factory holding all the Descents, which
// must be referred to by ID
EFactory<DescentPos> pf_; // factory holding all the DescentPoss, which
// must be referred to by ID
EList<DescentRoot> roots_; // search roots
EList<DescentConfig> confs_; // configuration params for each root
size_t rootsInited_; // # initial Descents already created
EHeap<TDescentPair> heap_; // priority queue of Descents
DescentAlignmentSink<index_t> alsink_; // alignment sink
DescentRedundancyChecker re_; // redundancy checker
TAlScore curPen_; // current penalty
bool veryVerbose_; // print lots of partial alignments
EList<Edit> tmpedit_;
BTDnaString tmprfdnastr_;
};
/**
* Selects alignments to report from a complete non-empty stratum of
* alignments stored in the DescentAlignmentSink.
*/
template <typename index_t>
class DescentAlignmentSelector {
public:
DescentAlignmentSelector() : gwstate_(GW_CAT) { reset(); }
/**
* Initialize a new selector w/r/t a DescentAlignmentSink holding a
* non-empty alignment stratum.
*/
void init(
const Read& q,
const DescentAlignmentSink<index_t>& sink,
const GFM<index_t>& gfmFw, // forward Bowtie index for walking left
const BitPairReference& ref, // bitpair-encoded reference
RandomSource& rnd, // pseudo-random generator for sampling rows
WalkMetrics& met)
{
// We're going to sample from space of *alignments*, not ranges. So
// when we extract a sample, we'll have to do a little extra work to
// convert it to a <range, offset> coordinate.
rnd_.init(
sink.nelt(), // # elements to choose from
true); // without replacement
offs_.resize(sink.nelt());
offs_.fill(std::numeric_limits<TIndexOffU>::max());
sas_.resize(sink.nrange());
gws_.resize(sink.nrange());
size_t ei = 0;
for(size_t i = 0; i < sas_.size(); i++) {
size_t en = sink[i].botf - sink[i].topf;
sas_[i].init(sink[i].topf, q.length(), EListSlice<TIndexOffU, 16>(offs_, ei, en));
gws_[i].init(gfmFw, ref, sas_[i], rnd, met);
ei += en;
}
}
/**
* Reset the selector.
*/
void reset() {
rnd_.reset();
}
/**
* Return true iff the selector is currently initialized.
*/
bool inited() const {
return rnd_.size() > 0;
}
/**
* Get next alignment and convert it to an AlnRes.
*/
bool next(
const DescentDriver<index_t>& dr,
const GFM<index_t>& gfmFw, // forward Bowtie index for walking left
const BitPairReference& ref, // bitpair-encoded reference
RandomSource& rnd,
AlnRes& rs,
WalkMetrics& met,
PerReadMetrics& prm)
{
// Sample one alignment randomly from pool of remaining alignments
size_t ri = (size_t)rnd_.next(rnd);
size_t off = 0;
DescentAlignment al;
size_t rangei = 0;
// Convert random alignment index into a <range, offset> coordinate
dr.sink().elt(ri, al, rangei, off);
assert_lt(off, al.size());
Coord refcoord;
WalkResult<index_t> wr;
TIndexOffU tidx = 0, toff = 0, tlen = 0;
gws_[rangei].advanceElement(
(TIndexOffU)off,
gfmFw, // forward Bowtie index for walking left
ref, // bitpair-encoded reference
sas_[rangei], // SA range with offsets
gwstate_, // GroupWalk state; scratch space
wr, // put the result here
met, // metrics
prm); // per-read metrics
assert_neq(OFF_MASK, wr.toff);
bool straddled = false;
gfmFw.joinedToTextOff(
wr.elt.len,
wr.toff,
tidx,
toff,
tlen,
true, // reject straddlers?
straddled); // straddled?
if(tidx == OFF_MASK) {
// The seed hit straddled a reference boundary so the seed
// hit isn't valid
return false;
}
// Coordinate of the seed hit w/r/t the pasted reference string
refcoord.init(tidx, (int64_t)toff, dr.sink()[rangei].fw);
const EList<Edit>& edits = dr.sink().edits();
size_t ns = 0, ngap = 0, nrefn = 0;
for(size_t i = al.ei; i < al.ei + al.en; i++) {
if(edits[i].qchr == 'N' || edits[i].chr == 'N') ns++;
if(edits[i].chr == 'N') nrefn++;
if(edits[i].isGap()) ngap++;
}
AlnScore asc(
-dr.sink().bestPenalty(), // numeric score
ns, // # Ns
ngap); // # gaps
rs.init(
dr.query().length(), // # chars after hard trimming
asc, // alignment score
&dr.sink().edits(), // nucleotide edits array
al.ei, // nucleotide edits first pos
al.en, // nucleotide edits last pos
NULL, // ambig base array
0, // ambig base first pos
0, // ambig base last pos
refcoord, // coord of leftmost aligned char in ref
tlen, // length of reference aligned to
-1, // # seed mms allowed
-1, // seed length
-1, // seed interval
dr.minScore(), // minimum score for valid alignment
-1, // nuc5p (for colorspace)
-1, // nuc3p (for colorspace)
false, // soft pre-trimming?
0, // 5p pre-trimming
0, // 3p pre-trimming
false, // soft trimming?
0, // 5p trimming
0); // 3p trimming
rs.setRefNs(nrefn);
return true;
}
/**
* Return true iff all elements have been reported.
*/
bool done() const {
return rnd_.done();
}
/**
* Return the total size occupued by the Descent driver and all its
* constituent parts.
*/
size_t totalSizeBytes() const {
return rnd_.totalSizeBytes() +
offs_.totalSizeBytes() +
sas_.totalSizeBytes() +
gws_.totalSizeBytes();
}
/**
* Return the total capacity of the Descent driver and all its constituent
* parts.
*/
size_t totalCapacityBytes() const {
return rnd_.totalCapacityBytes() +
offs_.totalCapacityBytes() +
sas_.totalCapacityBytes() +
gws_.totalCapacityBytes();
}
protected:
Random1toN rnd_;
EList<TIndexOffU, 16> offs_;
EList<SARangeWithOffs<EListSlice<TIndexOffU, 16>, index_t> > sas_;
EList<GroupWalk2S<index_t, EListSlice<TIndexOffU, 16>, 16> > gws_;
GroupWalkState<index_t> gwstate_;
};
/**
* Selects and prioritizes partial alignments from the heap of the
* DescentDriver. We assume that the heap is no longer changing (i.e. that the
* DescentDriver is done). Usually, the user will then attempt to extend the
* partial alignments into full alignments. This can happen incrementally;
* that is, the user might ask for the partial alignments one "batch" at a
* time, and the selector will only do as much work is necessary to supply each
* requesteded batch.
*
* The actual work done here includes: (a) scanning the heap for high-priority
* partial alignments, (b) setting up the rnd_, offs_, sas_, gws_, and gwstate_
* fields and resolving offsets of partial alignments, (c) packaging and
* delivering batches of results to the caller.
*
* How to prioritize partial alignments? One idea is to use the same
* penalty-based prioritization used in the heap. This has pros: (a) maintains
* the guarantee that we're visiting alignments in best-to-worst order in
* end-to-end alignment mode, (b) the heap is already prioritized this way, so
* it's easier for us to compile high-priority partial alignments. But the con
* is that it doesn't take depth into account, which could mean that we're
* extending a lot of very short partial alignments first.
*
* A problem we should keep in mind is that some
*/
template <typename index_t>
class DescentPartialAlignmentSelector {
public:
DescentPartialAlignmentSelector() : gwstate_(GW_CAT) { reset(); }
/**
* Initialize a new selector w/r/t a read, index and heap of partial
* alignments.
*/
void init(
const Read& q, // read
const EHeap<TDescentPair>& heap, // the heap w/ the partial alns
TAlScore depthBonus, // use depth when prioritizing
size_t nbatch, // # of alignments in a batch
const GFM<index_t>& gfmFw, // forward Bowtie index for walk-left
const BitPairReference& ref, // bitpair-encoded reference
RandomSource& rnd, // pseudo-randoms for sampling rows
WalkMetrics& met) // metrics re: offset resolution
{
// Make our internal heap
if(depthBonus > 0) {
heap_.clear();
for(size_t i = 0; i < heap.size(); i++) {
TDescentPair p = heap[i];
p.first.pen += depthBonus * p.first.depth;
heap_.insert(p);
}
} else {
heap_ = heap;
}
#if 0
// We're going to sample from space of *alignments*, not ranges. So
// when we extract a sample, we'll have to do a little extra work to
// convert it to a <range, offset> coordinate.
rnd_.init(
sink.nelt(), // # elements to choose from
true); // without replacement
offs_.resize(sink.nelt());
offs_.fill(std::numeric_limits<TIndexOff>::max());
sas_.resize(sink.nrange());
gws_.resize(sink.nrange());
size_t ei = 0;
for(size_t i = 0; i < sas_.size(); i++) {
size_t en = sink[i].botf - sink[i].topf;
sas_[i].init(sink[i].topf, q.length(), EListSlice<TIndexOff, 16>(offs_, ei, en));
gws_[i].init(gfmFw, ref, sas_[i], rnd, met);
ei += en;
}
#endif
}
/**
*
*/
void compileBatch() {
}
/**
* Reset the selector.
*/
void reset() {
heap_.clear();
}
/**
* Return true iff the selector is currently initialized.
*/
bool inited() const {
return !heap_.empty();
}
/**
* Get next alignment and convert it to an AlnRes.
*/
bool next(
const DescentDriver<index_t>& dr,
const GFM<index_t>& gfmFw, // forward Bowtie index for walking left
const BitPairReference& ref, // bitpair-encoded reference
RandomSource& rnd,
AlnRes& rs,
WalkMetrics& met,
PerReadMetrics& prm)
{
// Sample one alignment randomly from pool of remaining alignments
size_t ri = (size_t)rnd_.next(rnd);
size_t off = 0;
DescentAlignment al;
size_t rangei = 0;
// Convert random alignment index into a <range, offset> coordinate
dr.sink().elt(ri, al, rangei, off);
assert_lt(off, al.size());
Coord refcoord;
WalkResult<index_t> wr;
uint32_t tidx = 0, toff = 0, tlen = 0;
gws_[rangei].advanceElement(
(uint32_t)off,
gfmFw, // forward Bowtie index for walking left
ref, // bitpair-encoded reference
sas_[rangei], // SA range with offsets
gwstate_, // GroupWalk state; scratch space
wr, // put the result here
met, // metrics
prm); // per-read metrics
assert_neq(0xffffffff, wr.toff);
bool straddled = false;
gfmFw.joinedToTextOff(
wr.elt.len,
wr.toff,
tidx,
toff,
tlen,
true, // reject straddlers?
straddled); // straddled?
if(tidx == 0xffffffff) {
// The seed hit straddled a reference boundary so the seed
// hit isn't valid
return false;
}
// Coordinate of the seed hit w/r/t the pasted reference string
refcoord.init(tidx, (int64_t)toff, dr.sink()[rangei].fw);
const EList<Edit>& edits = dr.sink().edits();
size_t ns = 0, ngap = 0, nrefn = 0;
for(size_t i = al.ei; i < al.ei + al.en; i++) {
if(edits[i].qchr == 'N' || edits[i].chr == 'N') ns++;
if(edits[i].chr == 'N') nrefn++;
if(edits[i].isGap()) ngap++;
}
return true;
}
/**
* Return true iff all elements have been reported.
*/
bool done() const {
return rnd_.done();
}
/**
* Return the total size occupued by the Descent driver and all its
* constituent parts.
*/
size_t totalSizeBytes() const {
return heap_.totalSizeBytes() +
rnd_.totalSizeBytes() +
offs_.totalSizeBytes() +
sas_.totalSizeBytes() +
gws_.totalSizeBytes();
}
/**
* Return the total capacity of the Descent driver and all its constituent
* parts.
*/
size_t totalCapacityBytes() const {
return heap_.totalCapacityBytes() +
rnd_.totalCapacityBytes() +
offs_.totalCapacityBytes() +
sas_.totalCapacityBytes() +
gws_.totalCapacityBytes();
}
protected:
// This class's working heap. This might simply be a copy of the original
// heap, or it might be re-prioritized in some way.
EHeap<TDescentPair> heap_;
Random1toN rnd_;
EList<TIndexOff, 16> offs_;
EList<SARangeWithOffs<EListSlice<TIndexOff, 16>, index_t> > sas_;
EList<GroupWalk2S<index_t, EListSlice<TIndexOff, 16>, 16> > gws_;
GroupWalkState<index_t> gwstate_;
};
/**
* Drive the process of descending from all search roots.
*/
template <typename index_t>
void DescentDriver<index_t>::go(
const Scoring& sc, // scoring scheme
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentMetrics& met, // metrics
PerReadMetrics& prm) // per-read metrics
{
assert(q_.repOk());
// Convert DescentRoots to the initial Descents
for(size_t i = 0; i < roots_.size(); i++) {
size_t dfsz = df_.size();
size_t pfsz = pf_.size();
TDescentId id = df_.alloc();
Edit e_null;
assert(!e_null.inited());
bool succ = df_[id].init(
q_, // read
i, // root and conf id
sc, // scoring scheme
minsc_, // minimum score
maxpen_, // maximum penalty
id, // new Descent's id
gfmFw, // forward index
gfmBw, // mirror index
re_, // redundancy checker
df_, // Descent factory
pf_, // DescentPos factory
roots_, // DescentRoots
confs_, // DescentConfs
heap_, // heap
alsink_, // alignment sink
met, // metrics
prm); // per-read metrics
if(veryVerbose_) {
bool fw = roots_[i].fw;
tmpedit_.clear();
df_[id].print(
&cerr,
"",
q_,
0,
0,
fw,
tmpedit_,
0,
tmpedit_.size(),
tmprfdnastr_);
}
if(!succ) {
// Reclaim memory we had used for this descent and its DescentPos info
df_.resize(dfsz);
pf_.resize(pfsz);
}
}
// Advance until some stopping condition
bool stop = heap_.empty();
while(!stop) {
// Pop off the highest-priority descent. Note that some outgoing edges
// might have since been explored, which could reduce the priority of
// the descent once we .
TDescentPair p = heap_.pop();
df_.alloc(); df_.pop();
df_[p.second].followBestOutgoing(
q_, // read
gfmFw, // index over text
gfmBw, // index over reverse text
sc, // scoring scheme
minsc_, // minimum score
maxpen_, // maximum penalty
re_, // redundancy checker
df_, // Descent factory
pf_, // DescentPos factory
roots_, //
confs_, //
heap_, // priority queue for Descents
alsink_, // alignment sink
met, // metrics
prm); // per-read metrics
stop = heap_.empty();
}
}
/**
* Perform seed alignment until some stopping condition is satisfied.
*/
template <typename index_t>
int DescentDriver<index_t>::advance(
const DescentStoppingConditions& stopc, // stopping conditions
const Scoring& sc, // scoring scheme
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentMetrics& met, // metrics
PerReadMetrics& prm) // per-read metrics
{
size_t nbwop_i = met.bwops;
while(rootsInited_ < roots_.size()) {
size_t dfsz = df_.size();
size_t pfsz = pf_.size();
TDescentId id = df_.alloc();
Edit e_null;
assert(!e_null.inited());
bool succ = df_[id].init(
q_, // query
rootsInited_, // root and conf id
sc, // scoring scheme
minsc_, // minimum score
maxpen_, // maximum penalty
id, // new Descent's id
gfmFw, // forward index
gfmBw, // mirror index
re_, // redundancy checker
df_, // Descent factory
pf_, // DescentPos factory
roots_, // DescentRoots
confs_, // DescentConfs
heap_, // heap
alsink_, // alignment sink
met, // metrics
prm); // per-read metrics
if(!succ) {
// Reclaim memory we had used for this descent and its DescentPos info
df_.resize(dfsz);
pf_.resize(pfsz);
}
rootsInited_++;
TAlScore best = std::numeric_limits<TAlScore>::max();
if(!heap_.empty()) {
best = heap_.top().first.pen;
}
if(stopc.nfound > 0 && alsink_.nelt() > stopc.nfound) {
return DESCENT_DRIVER_ALN;
}
if(alsink_.stratumDone(best)) {
return DESCENT_DRIVER_STRATA;
}
if(stopc.nbwop > 0 && (met.bwops - nbwop_i) > stopc.nbwop) {
return DESCENT_DRIVER_BWOPS;
}
if(stopc.totsz > 0 && totalSizeBytes() > stopc.totsz) {
return DESCENT_DRIVER_MEM;
}
}
// Advance until some stopping condition
bool stop = heap_.empty();
while(!stop) {
// Pop off the highest-priority descent. Note that some outgoing edges
// might have since been explored, which could reduce the priority of
// the descent once we .
TDescentPair p = heap_.pop();
df_.alloc(); df_.pop();
df_[p.second].followBestOutgoing(
q_,
gfmFw,
gfmBw,
sc,
minsc_, // minimum score
maxpen_, // maximum penalty
re_, // redundancy checker
df_, // Descent factory
pf_, // DescentPos factory
roots_,
confs_,
heap_,
alsink_,
met,
prm); // per-read metrics
TAlScore best = std::numeric_limits<TAlScore>::max();
if(!heap_.empty()) {
best = heap_.top().first.pen;
}
if(stopc.nfound > 0 && alsink_.nelt() > stopc.nfound) {
return DESCENT_DRIVER_ALN;
}
if(alsink_.stratumDone(best)) {
return DESCENT_DRIVER_STRATA;
}
if(stopc.nbwop > 0 && (met.bwops - nbwop_i) > stopc.nbwop) {
return DESCENT_DRIVER_BWOPS;
}
if(stopc.totsz > 0 && totalSizeBytes() > stopc.totsz) {
return DESCENT_DRIVER_MEM;
}
stop = heap_.empty();
}
return DESCENT_DRIVER_DONE;
}
/**
* If this is the final descent in a complete end-to-end alignment, report
* the alignment.
*/
template <typename index_t>
bool DescentAlignmentSink<index_t>::reportAlignment(
const Read& q, // query string
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
TIndexOffU topf, // SA range top in forward index
TIndexOffU botf, // SA range bottom in forward index
TIndexOffU topb, // SA range top in backward index
TIndexOffU botb, // SA range bottom in backward index
TDescentId id, // id of leaf Descent
TRootId rid, // id of search root
const Edit& e, // final edit, if needed
TScore pen, // total penalty
EFactory<Descent<index_t> >& df, // factory with Descent
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs) // configs
{
TDescentId cur = id;
ASSERT_ONLY(const Descent<index_t>& desc = df[id]);
const bool fw = rs[rid].fw;
ASSERT_ONLY(size_t len = q.length());
assert(q.repOk());
assert_lt(desc.al5pf(), len);
// Adjust al5pi and al5pf to take the final edit into account (if
// there is one)
// Check if this is redundant with a previous reported alignment
Triple<TIndexOffU, TIndexOffU, size_t> lhs(topf, botf, 0);
Triple<TIndexOffU, TIndexOffU, size_t> rhs(topb, botb, q.length()-1);
if(!lhs_.insert(lhs)) {
rhs_.insert(rhs);
return false; // Already there
}
if(!rhs_.insert(rhs)) {
return false; // Already there
}
size_t ei = edits_.size();
df[cur].collectEdits(edits_, &e, df);
size_t en = edits_.size() - ei;
#ifndef NDEBUG
{
for(size_t i = 1; i < en; i++) {
assert_geq(edits_[ei+i].pos, edits_[ei+i-1].pos);
}
// Now figure out how much we refrained from aligning on either
// side.
size_t trimLf = 0;
size_t trimRg = 0;
BTDnaString& rf = tmprfdnastr_;
rf.clear();
if(!fw) {
// Edit offsets are w/r/t 5' end, but desc.print wants them w/r/t
// the *left* end of the read sequence that aligned
Edit::invertPoss(edits_, len, ei, en, true);
}
desc.print(NULL, "", q, trimLf, trimRg, fw, edits_, ei, en, rf);
if(!fw) {
// Invert them back to how they were before
Edit::invertPoss(edits_, len, ei, en, true);
}
ASSERT_ONLY(TIndexOffU toptmp = 0);
ASSERT_ONLY(TIndexOffU bottmp = 0);
// Check that the edited string occurs in the reference
if(!gfmFw.contains(rf, &toptmp, &bottmp)) {
std::cerr << rf << std::endl;
assert(false);
}
}
#endif
als_.expand();
als_.back().init(pen, fw, topf, botf, ei, en);
nelt_ += (botf - topf);
if(bestPen_ == std::numeric_limits<TAlScore>::max() || pen < bestPen_) {
bestPen_ = pen;
}
if(worstPen_ == std::numeric_limits<TAlScore>::max() || pen > worstPen_) {
worstPen_ = pen;
}
return true;
}
/**
* Initialize a new descent branching from the given descent via the given
* edit. Return false if the Descent has no outgoing edges (and can
* therefore have its memory freed), true otherwise.
*/
template <typename index_t>
bool Descent<index_t>::init(
const Read& q, // query
TRootId rid, // root id
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
TReadOff al5pi, // offset from 5' of 1st aligned char
TReadOff al5pf, // offset from 5' of last aligned char
TIndexOffU topf, // SA range top in FW index
TIndexOffU botf, // SA range bottom in FW index
TIndexOffU topb, // SA range top in BW index
TIndexOffU botb, // SA range bottom in BW index
bool l2r, // direction this descent will go in
size_t descid, // my ID
TDescentId parent, // parent ID
TScore pen, // total penalties so far
const Edit& e, // edit for incoming edge
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent>& df, // Descent factory
EFactory<DescentPos>& pf, // DescentPos factory
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm) // per-read metrics
{
assert(q.repOk());
rid_ = rid;
al5pi_ = al5pi;
al5pf_ = al5pf;
l2r_ = l2r;
topf_ = topf;
botf_ = botf;
topb_ = topb;
botb_ = botb;
descid_ = descid;
parent_ = parent;
pen_ = pen;
posid_ = std::numeric_limits<size_t>::max();
len_ = 0;
out_.clear();
edit_ = e;
lastRecalc_ = true;
gapadd_ = df[parent].gapadd_;
if(e.inited()) {
if(e.isReadGap()) {
gapadd_++;
} else if(e.isRefGap()) {
gapadd_--;
}
}
bool branches = false, hitEnd = false, done = false;
TIndexOffU topf_new = 0, botf_new = 0, topb_new = 0, botb_new = 0;
off5p_i_ = 0;
#ifndef NDEBUG
size_t depth = al5pf_ - al5pi_ + 1;
TAlScore maxpend = cs[rid_].cons.get(depth, q.length(), maxpen);
assert_geq(maxpend, pen_); // can't have already exceeded max penalty
#endif
bool matchSucc = followMatches(
q,
sc,
gfmFw,
gfmBw,
re,
df,
pf,
rs,
cs,
heap,
alsink,
met,
prm,
branches,
hitEnd,
done,
off5p_i_,
topf_new,
botf_new,
topb_new,
botb_new);
bool bounceSucc = false;
if(matchSucc && hitEnd && !done) {
assert(topf_new > 0 || botf_new > 0);
bounceSucc = bounce(
q,
topf_new,
botf_new,
topb_new,
botb_new,
gfmFw,
gfmBw,
sc,
minsc, // minimum score
maxpen, // maximum penalty
re,
df,
pf,
rs,
cs,
heap,
alsink,
met, // descent metrics
prm); // per-read metrics
}
if(matchSucc) {
// Calculate info about outgoing edges
recalcOutgoing(q, sc, minsc, maxpen, re, pf, rs, cs, prm);
if(!empty()) {
heap.insert(make_pair(out_.bestPri(), descid)); // Add to heap
}
}
return !empty() || bounceSucc;
}
/**
* Initialize a new descent beginning at the given root. Return false if
* the Descent has no outgoing edges (and can therefore have its memory
* freed), true otherwise.
*/
template <typename index_t>
bool Descent<index_t>::init(
const Read& q, // query
TRootId rid, // root id
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
size_t descid, // id of this Descent
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent<index_t> >& df, // Descent factory
EFactory<DescentPos>& pf, // DescentPos factory
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm) // per-read metrics
{
rid_ = rid;
al5pi_ = rs[rid].off5p;
al5pf_ = rs[rid].off5p;
assert_lt(al5pi_, q.length());
assert_lt(al5pf_, q.length());
l2r_ = rs[rid].l2r;
topf_ = botf_ = topb_ = botb_ = 0;
descid_ = descid;
parent_ = std::numeric_limits<size_t>::max();
pen_ = 0;
posid_ = std::numeric_limits<size_t>::max();
len_ = 0;
out_.clear();
edit_.reset();
lastRecalc_ = true;
gapadd_ = 0;
bool branches = false, hitEnd = false, done = false;
TIndexOffU topf_new = 0, botf_new = 0, topb_new = 0, botb_new = 0;
off5p_i_ = 0;
bool matchSucc = followMatches(
q,
sc,
gfmFw,
gfmBw,
re,
df,
pf,
rs,
cs,
heap,
alsink,
met,
prm,
branches,
hitEnd,
done,
off5p_i_,
topf_new,
botf_new,
topb_new,
botb_new);
bool bounceSucc = false;
if(matchSucc && hitEnd && !done) {
assert(topf_new > 0 || botf_new > 0);
bounceSucc = bounce(
q,
topf_new,
botf_new,
topb_new,
botb_new,
gfmFw,
gfmBw,
sc,
minsc, // minimum score
maxpen, // maximum penalty
re,
df,
pf,
rs,
cs,
heap,
alsink,
met, // descent metrics
prm); // per-read metrics
}
// Calculate info about outgoing edges
assert(empty());
if(matchSucc) {
recalcOutgoing(q, sc, minsc, maxpen, re, pf, rs, cs, prm);
if(!empty()) {
heap.insert(make_pair(out_.bestPri(), descid)); // Add to heap
}
}
return !empty() || bounceSucc;
}
/**
* Recalculate our summary of the outgoing edges from this descent. When
* deciding what outgoing edges are legal, we abide by constraints.
* Typically, they limit the total of the penalties accumulated so far, as
* a function of distance from the search root. E.g. a constraint might
* disallow any gaps or mismatches within 20 ply of the search root, then
* allow 1 mismatch within 30 ply, then allow up to 1 mismatch or 1 gap
* within 40 ply, etc.
*
* Return the total number of valid outgoing edges found.
*
* TODO: Eliminate outgoing gap edges that are redundant with others owing to
* the DNA sequence and the fact that we don't care to distinguish among
* "equivalent" homopolymer extensinos and retractions.
*/
template <typename index_t>
size_t Descent<index_t>::recalcOutgoing(
const Read& q, // query string
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
DescentRedundancyChecker& re, // redundancy checker
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
PerReadMetrics& prm) // per-read metrics
{
assert_eq(botf_ - topf_, botb_ - topb_);
assert(out_.empty());
assert(repOk(&q));
// Get initial 5' and 3' offsets
bool fw = rs[rid_].fw;
float rootpri = rs[rid_].pri;
bool toward3p = (l2r_ == fw);
size_t off5p = off5p_i_;
assert_geq(al5pf_, al5pi_);
size_t off3p = q.length() - off5p - 1;
// By "depth" we essentially mean the number of characters already aligned
size_t depth, extrai = 0, extraf = 0;
size_t cur5pi = al5pi_, cur5pf = al5pf_;
if(toward3p) {
// Toward 3'
cur5pf = off5p;
depth = off5p - al5pi_;
// Failed to match out to the end?
if(al5pf_ < q.length() - 1) {
extraf = 1; // extra
}
} else {
// Toward 5'
cur5pi = off5p;
depth = al5pf_ - off5p;
if(al5pi_ > 0) {
extrai = 1;
}
}
// Get gap penalties
TScore pen_rdg_ex = sc.readGapExtend(), pen_rfg_ex = sc.refGapExtend();
TScore pen_rdg_op = sc.readGapOpen(), pen_rfg_op = sc.refGapOpen();
// Top and bot in the direction of the descent
TIndexOffU top = l2r_ ? topb_ : topf_;
TIndexOffU bot = l2r_ ? botb_ : botf_;
// Top and bot in the opposite direction
TIndexOffU topp = l2r_ ? topf_ : topb_;
TIndexOffU botp = l2r_ ? botf_ : botb_;
assert_eq(botp - topp, bot - top);
DescentEdge edge;
size_t nout = 0;
// Enumerate all outgoing edges, starting at the root and going out
size_t d = posid_;
// At first glance, we might think we should be bounded by al5pi_ and
// al5pf_, but those delimit the positions that matched between reference
// and read. If we hit a position that failed to match as part of
// followMatches, then we also want to evaluate ways of leaving that
// position, which adds one more position to viist.
while(off5p >= al5pi_ - extrai && off5p <= al5pf_ + extraf) {
assert_lt(off5p, q.length());
assert_lt(off3p, q.length());
TScore maxpend = cs[rid_].cons.get(depth, q.length(), maxpen);
assert(depth > 0 || maxpend == 0);
assert_geq(maxpend, pen_); // can't have already exceeded max penalty
TScore diff = maxpend - pen_; // room we have left
// Get pointer to SA ranges in the direction of descent
const TIndexOffU *t = l2r_ ? pf[d].topb : pf[d].topf;
const TIndexOffU *b = l2r_ ? pf[d].botb : pf[d].botf;
const TIndexOffU *tp = l2r_ ? pf[d].topf : pf[d].topb;
const TIndexOffU *bp = l2r_ ? pf[d].botf : pf[d].botb;
assert_eq(pf[d].botf - pf[d].topf, pf[d].botb - pf[d].topb);
// What are the read char / quality?
std::pair<int, int> p = q.get(off5p, fw);
int c = p.first;
assert_range(0, 4, c);
// Only entertain edits if there is at least one type of edit left and
// there is some penalty budget left
if(!pf[d].flags.exhausted() && diff > 0) {
// What would the penalty be if we mismatched at this position?
// This includes the case where the mismatch is for an N in the
// read.
int qq = p.second;
assert_geq(qq, 0);
TScore pen_mm = sc.mm(c, qq);
if(pen_mm <= diff) {
for(int j = 0; j < 4; j++) {
if(j == c) continue; // Match, not mismatch
if(b[j] <= t[j]) {
continue; // No outgoing edge with this nucleotide
}
if(!pf[d].flags.mmExplore(j)) {
continue; // Already been explored
}
TIndexOffU topf = pf[d].topf[j], botf = pf[d].botf[j];
ASSERT_ONLY(TIndexOffU topb = pf[d].topb[j], botb = pf[d].botb[j]);
if(re.contains(fw, l2r_, cur5pi, cur5pf, cur5pf - cur5pi + 1 + gapadd_, topf, botf, pen_ + pen_mm)) {
prm.nRedSkip++;
continue; // Redundant with a path already explored
}
prm.nRedFail++;
TIndexOffU width = b[j] - t[j];
Edit edit((uint32_t)off5p, (int)("ACGTN"[j]), (int)("ACGTN"[c]), EDIT_TYPE_MM);
DescentPriority pri(pen_ + pen_mm, depth, width, rootpri);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
assert_eq(botb - topb, botf - topf);
edge.init(edit, off5p, pri, d
#ifndef NDEBUG
, d, topf, botf, topb, botb
#endif
);
out_.update(edge);
nout++;
}
}
bool gapsAllowed = (off5p >= (size_t)sc.gapbar && off3p >= (size_t)sc.gapbar);
if(gapsAllowed) {
assert_gt(depth, 0);
// An easy redundancy check is: if all ways of proceeding are
// matches, then there's no need to entertain gaps here.
// Shifting the gap one position further downstream is
// guarnteed not to be worse.
size_t totwidth = (b[0] - t[0]) +
(b[1] - t[1]) +
(b[2] - t[2]) +
(b[3] - t[3]);
assert(c > 3 || b[c] - t[c] <= totwidth);
bool allmatch = c < 4 && (totwidth == (b[c] - t[c]));
bool rdex = false, rfex = false;
size_t cur5pi_i = cur5pi, cur5pf_i = cur5pf;
if(toward3p) {
cur5pf_i--;
} else {
cur5pi_i++;
}
if(off5p == off5p_i_ && edit_.inited()) {
// If we're at the root of the descent, and the descent
// branched on a gap, then this could be scored as an
// extension of that gap.
if(pen_rdg_ex <= diff && edit_.isReadGap()) {
// Extension of a read gap
rdex = true;
for(int j = 0; j < 4; j++) {
if(b[j] <= t[j]) {
continue; // No outgoing edge with this nucleotide
}
if(!pf[d].flags.rdgExplore(j)) {
continue; // Already been explored
}
TIndexOffU topf = pf[d].topf[j], botf = pf[d].botf[j];
ASSERT_ONLY(TIndexOffU topb = pf[d].topb[j], botb = pf[d].botb[j]);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
if(re.contains(fw, l2r_, cur5pi_i, cur5pf_i, cur5pf - cur5pi + 1 + gapadd_, topf, botf, pen_ + pen_rdg_ex)) {
prm.nRedSkip++;
continue; // Redundant with a path already explored
}
prm.nRedFail++;
TIndexOffU width = b[j] - t[j];
// off5p holds the offset from the 5' of the next
// character we were trying to align when we decided to
// introduce a read gap (before that character). If we
// were walking toward the 5' end, we need to increment
// by 1.
uint32_t off = (uint32_t)off5p + (toward3p ? 0 : 1);
Edit edit(off, (int)("ACGTN"[j]), '-', EDIT_TYPE_READ_GAP);
assert(edit.pos2 != std::numeric_limits<uint32_t>::max());
edit.pos2 = edit_.pos2 + (toward3p ? 1 : -1);
DescentPriority pri(pen_ + pen_rdg_ex, depth, width, rootpri);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
assert_eq(botb - topb, botf - topf);
edge.init(edit, off5p, pri, d
#ifndef NDEBUG
, d,
topf, botf, topb, botb
#endif
);
out_.update(edge);
nout++;
}
}
if(pen_rfg_ex <= diff && edit_.isRefGap()) {
// Extension of a reference gap
rfex = true;
if(pf[d].flags.rfgExplore()) {
TIndexOffU topf = l2r_ ? topp : top;
TIndexOffU botf = l2r_ ? botp : bot;
ASSERT_ONLY(TIndexOffU topb = l2r_ ? top : topp);
ASSERT_ONLY(TIndexOffU botb = l2r_ ? bot : botp);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
size_t nrefal = cur5pf - cur5pi + gapadd_;
if(!re.contains(fw, l2r_, cur5pi, cur5pf, nrefal, topf, botf, pen_ + pen_rfg_ex)) {
TIndexOffU width = bot - top;
Edit edit((uint32_t)off5p, '-', (int)("ACGTN"[c]), EDIT_TYPE_REF_GAP);
DescentPriority pri(pen_ + pen_rfg_ex, depth, width, rootpri);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
edge.init(edit, off5p, pri, d
#ifndef NDEBUG
// It's a little unclear what the depth ought to be.
// Is it the depth we were at when we did the ref
// gap? I.e. the depth of the flags where rfgExplore()
// returned true? Or is it the depth where we can
// retrieve the appropriate top/bot? We make it the
// latter, might wrap around, indicating we should get
// top/bot from the descent's topf_, ... fields.
, (d == posid_) ? std::numeric_limits<size_t>::max() : (d - 1),
topf, botf, topb, botb
#endif
);
out_.update(edge);
nout++;
prm.nRedFail++;
} else {
prm.nRedSkip++;
}
}
}
}
if(!allmatch && pen_rdg_op <= diff && !rdex) {
// Opening a new read gap
for(int j = 0; j < 4; j++) {
if(b[j] <= t[j]) {
continue; // No outgoing edge with this nucleotide
}
if(!pf[d].flags.rdgExplore(j)) {
continue; // Already been explored
}
TIndexOffU topf = pf[d].topf[j], botf = pf[d].botf[j];
ASSERT_ONLY(TIndexOffU topb = pf[d].topb[j], botb = pf[d].botb[j]);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
if(re.contains(fw, l2r_, cur5pi_i, cur5pf_i, cur5pf - cur5pi + 1 + gapadd_, topf, botf, pen_ + pen_rdg_op)) {
prm.nRedSkip++;
continue; // Redundant with a path already explored
}
prm.nRedFail++;
TIndexOffU width = b[j] - t[j];
// off5p holds the offset from the 5' of the next
// character we were trying to align when we decided to
// introduce a read gap (before that character). If we
// were walking toward the 5' end, we need to increment
// by 1.
uint32_t off = (uint32_t)off5p + (toward3p ? 0 : 1);
Edit edit(off, (int)("ACGTN"[j]), '-', EDIT_TYPE_READ_GAP);
assert(edit.pos2 != std::numeric_limits<uint32_t>::max());
DescentPriority pri(pen_ + pen_rdg_op, depth, width, rootpri);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
assert_eq(botb - topb, botf - topf);
edge.init(edit, off5p, pri, d
#ifndef NDEBUG
, d, topf, botf, topb, botb
#endif
);
out_.update(edge);
nout++;
}
}
if(!allmatch && pen_rfg_op <= diff && !rfex) {
// Opening a new reference gap
if(pf[d].flags.rfgExplore()) {
TIndexOffU topf = l2r_ ? topp : top;
TIndexOffU botf = l2r_ ? botp : bot;
ASSERT_ONLY(TIndexOffU topb = l2r_ ? top : topp);
ASSERT_ONLY(TIndexOffU botb = l2r_ ? bot : botp);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
size_t nrefal = cur5pf - cur5pi + gapadd_;
if(!re.contains(fw, l2r_, cur5pi, cur5pf, nrefal, topf, botf, pen_ + pen_rfg_op)) {
TIndexOffU width = bot - top;
Edit edit((uint32_t)off5p, '-', (int)("ACGTN"[c]), EDIT_TYPE_REF_GAP);
DescentPriority pri(pen_ + pen_rfg_op, depth, width, rootpri);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
edge.init(edit, off5p, pri, d
#ifndef NDEBUG
// It's a little unclear what the depth ought to be.
// Is it the depth we were at when we did the ref
// gap? I.e. the depth of the flags where rfgExplore()
// returned true? Or is it the depth where we can
// retrieve the appropriate top/bot? We make it the
// latter, might wrap around, indicating we should get
// top/bot from the descent's topf_, ... fields.
, (d == posid_) ? std::numeric_limits<size_t>::max() : (d - 1),
topf, botf, topb, botb
#endif
);
out_.update(edge);
nout++;
prm.nRedFail++;
} else {
prm.nRedSkip++;
}
}
}
}
}
// Update off5p, off3p, depth
d++;
depth++;
assert_leq(depth, al5pf_ - al5pi_ + 2);
if(toward3p) {
if(off3p == 0) {
break;
}
off5p++;
off3p--;
cur5pf++;
} else {
if(off5p == 0) {
break;
}
off3p++;
off5p--;
cur5pi--;
}
// Update top and bot
if(off5p >= al5pi_ - extrai && off5p <= al5pf_ + extraf) {
assert_range(0, 3, c);
top = t[c]; topp = tp[c];
bot = b[c]; botp = bp[c];
assert_eq(bot-top, botp-topp);
}
}
lastRecalc_ = (nout <= 5);
out_.best1.updateFlags(pf);
out_.best2.updateFlags(pf);
out_.best3.updateFlags(pf);
out_.best4.updateFlags(pf);
out_.best5.updateFlags(pf);
return nout;
}
template <typename index_t>
void Descent<index_t>::print(
std::ostream *os,
const char *prefix,
const Read& q,
size_t trimLf,
size_t trimRg,
bool fw,
const EList<Edit>& edits,
size_t ei,
size_t en,
BTDnaString& rf) const
{
const BTDnaString& read = fw ? q.patFw : q.patRc;
size_t eidx = ei;
if(os != NULL) { *os << prefix; }
// Print read
for(size_t i = 0; i < read.length(); i++) {
if(i < trimLf || i >= read.length() - trimRg) {
if(os != NULL) { *os << (char)tolower(read.toChar(i)); }
continue;
}
bool del = false, mm = false;
while(eidx < ei + en && edits[eidx].pos == i) {
if(edits[eidx].isReadGap()) {
if(os != NULL) { *os << '-'; }
} else if(edits[eidx].isRefGap()) {
del = true;
assert_eq((int)edits[eidx].qchr, read.toChar(i));
if(os != NULL) { *os << read.toChar(i); }
} else {
mm = true;
assert(edits[eidx].isMismatch());
assert_eq((int)edits[eidx].qchr, read.toChar(i));
if(os != NULL) { *os << (char)edits[eidx].qchr; }
}
eidx++;
}
if(!del && !mm) {
// Print read character
if(os != NULL) { *os << read.toChar(i); }
}
}
if(os != NULL) {
*os << endl;
*os << prefix;
}
eidx = ei;
// Print match bars
for(size_t i = 0; i < read.length(); i++) {
if(i < trimLf || i >= read.length() - trimRg) {
if(os != NULL) { *os << ' '; }
continue;
}
bool del = false, mm = false;
while(eidx < ei + en && edits[eidx].pos == i) {
if(edits[eidx].isReadGap()) {
if(os != NULL) { *os << ' '; }
} else if(edits[eidx].isRefGap()) {
del = true;
if(os != NULL) { *os << ' '; }
} else {
mm = true;
assert(edits[eidx].isMismatch());
if(os != NULL) { *os << ' '; }
}
eidx++;
}
if(!del && !mm && os != NULL) { *os << '|'; }
}
if(os != NULL) {
*os << endl;
*os << prefix;
}
eidx = ei;
// Print reference
for(size_t i = 0; i < read.length(); i++) {
if(i < trimLf || i >= read.length() - trimRg) {
if(os != NULL) { *os << ' '; }
continue;
}
bool del = false, mm = false;
while(eidx < ei + en && edits[eidx].pos == i) {
if(edits[eidx].isReadGap()) {
rf.appendChar((char)edits[eidx].chr);
if(os != NULL) { *os << (char)edits[eidx].chr; }
} else if(edits[eidx].isRefGap()) {
del = true;
if(os != NULL) { *os << '-'; }
} else {
mm = true;
assert(edits[eidx].isMismatch());
rf.appendChar((char)edits[eidx].chr);
if(os != NULL) { *os << (char)edits[eidx].chr; }
}
eidx++;
}
if(!del && !mm) {
rf.append(read[i]);
if(os != NULL) { *os << read.toChar(i); }
}
}
if(os != NULL) { *os << endl; }
}
/**
* Create a new Descent
*/
template <typename index_t>
bool Descent<index_t>::bounce(
const Read& q, // query string
TIndexOffU topf, // SA range top in fw index
TIndexOffU botf, // SA range bottom in fw index
TIndexOffU topb, // SA range top in bw index
TIndexOffU botb, // SA range bottom in bw index
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent<index_t> >& df, // factory with Descent
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap of descents
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm) // per-read metrics
{
assert_gt(botf, topf);
assert(al5pi_ == 0 || al5pf_ == q.length()-1);
assert(!(al5pi_ == 0 && al5pf_ == q.length()-1));
size_t dfsz = df.size();
size_t pfsz = pf.size();
TDescentId id = df.alloc();
Edit e_null;
assert(!e_null.inited());
// Follow matches
bool succ = df[id].init(
q, // query
rid_, // root id
sc, // scoring scheme
minsc, // minimum score
maxpen, // maximum penalty
al5pi_, // new near-5' extreme
al5pf_, // new far-5' extreme
topf, // SA range top in FW index
botf, // SA range bottom in FW index
topb, // SA range top in BW index
botb, // SA range bottom in BW index
!l2r_, // direction this descent will go in; opposite from parent
id, // my ID
descid_, // parent ID
pen_, // total penalties so far - same as parent
e_null, // edit for incoming edge; uninitialized if bounced
gfmFw, // forward index
gfmBw, // mirror index
re, // redundancy checker
df, // Descent factory
pf, // DescentPos factory
rs, // DescentRoot list
cs, // DescentConfig list
heap, // heap
alsink, // alignment sink
met, // metrics
prm); // per-read metrics
if(!succ) {
// Reclaim memory we had used for this descent and its DescentPos info
df.resize(dfsz);
pf.resize(pfsz);
}
return succ;
}
/**
* Take the best outgoing edge and place it in the heap. When deciding what
* outgoing edges exist, abide by constraints in DescentConfig. These
* constraints limit total penalty accumulated so far versus distance from
* search root. E.g. a constraint might disallow any gaps or mismatches within
* 20 ply of the root, then allow 1 mismatch within 30 ply, 1 mismatch or 1 gap
* within 40 ply, etc.
*/
template <typename index_t>
void Descent<index_t>::followBestOutgoing(
const Read& q, // query string
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent<index_t> >& df, // factory with Descent
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap of descents
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm) // per-read metrics
{
// We assume this descent has been popped off the heap. We'll re-add it if
// it hasn't been exhausted.
assert(q.repOk());
assert(!empty());
assert(!out_.empty());
while(!out_.empty()) {
DescentPriority best = out_.bestPri();
DescentEdge e = out_.rotate();
TReadOff al5pi_new = al5pi_, al5pf_new = al5pf_;
bool fw = rs[rid_].fw;
bool toward3p = (l2r_ == fw);
TReadOff edoff = e.off5p; // 5' offset of edit
assert_leq(edoff, al5pf_ + 1);
assert_geq(edoff + 1, al5pi_);
if(out_.empty()) {
if(!lastRecalc_) {
// This might allocate new Descents
recalcOutgoing(q, sc, minsc, maxpen, re, pf, rs, cs, prm);
if(empty()) {
// Could happen, since some outgoing edges may have become
// redundant in the meantime.
break;
}
} else {
assert(empty());
}
}
TReadOff doff; // edit's offset into this descent
int chr = asc2dna[e.e.chr];
// hitEnd is set to true iff this edit pushes us to the extreme 5' or 3'
// end of the alignment
bool hitEnd = false;
// done is set to true iff this edit aligns the only remaining character of
// the read
bool done = false;
if(toward3p) {
// The 3' extreme of the new Descent is further in (away from the 3'
// end) than the parent's.
al5pf_new = doff = edoff;
if(e.e.isReadGap()) {
// We didn't actually consume the read character at 'edoff', so
// retract al5pf_new by one position. This doesn't effect the
// "depth" (doff) of the SA range we took, though.
assert_gt(al5pf_new, 0);
al5pf_new--;
}
assert_lt(al5pf_new, q.length());
hitEnd = (al5pf_new == q.length() - 1);
done = (hitEnd && al5pi_new == 0);
assert_geq(doff, off5p_i_);
doff = doff - off5p_i_;
assert_leq(doff, len_);
} else {
// The 5' extreme of the new Descent is further in (away from the 5'
// end) than the parent's.
al5pi_new = doff = edoff;
if(e.e.isReadGap()) {
// We didn't actually consume the read character at 'edoff', so
// move al5pi_new closer to the 3' end by one position. This
// doesn't effect the "depth" (doff) of the SA range we took,
// though.
al5pi_new++;
}
hitEnd = (al5pi_new == 0);
done = (hitEnd && al5pf_new == q.length() - 1);
assert_geq(off5p_i_, doff);
doff = off5p_i_ - doff;
assert_leq(doff, len_);
}
// Check if this is redundant with an already-explored path
bool l2r = l2r_; // gets overridden if we bounce
if(!done && hitEnd) {
// Alignment finsihed extending in one direction
l2r = !l2r;
}
size_t dfsz = df.size();
size_t pfsz = pf.size();
TIndexOffU topf, botf, topb, botb;
size_t d = posid_ + doff;
if(e.e.isRefGap()) {
d--; // might underflow
if(doff == 0) {
topf = topf_;
botf = botf_;
topb = topb_;
botb = botb_;
d = std::numeric_limits<size_t>::max();
assert_eq(botf-topf, botb-topb);
} else {
assert_gt(al5pf_new, 0);
assert_gt(d, 0);
chr = pf[d].c;
assert(pf[d].inited());
assert_range(0, 3, chr);
topf = pf[d].topf[chr];
botf = pf[d].botf[chr];
topb = pf[d].topb[chr];
botb = pf[d].botb[chr];
assert_eq(botf-topf, botb-topb);
}
} else {
// A read gap or a mismatch
assert(pf[d].inited());
topf = pf[d].topf[chr];
botf = pf[d].botf[chr];
topb = pf[d].topb[chr];
botb = pf[d].botb[chr];
assert_eq(botf-topf, botb-topb);
}
assert_eq(d, e.d);
assert_eq(topf, e.topf);
assert_eq(botf, e.botf);
assert_eq(topb, e.topb);
assert_eq(botb, e.botb);
if(done) {
// Aligned the entire read end-to-end. Presumably there's no need to
// create a new Descent object. We just report the alignment.
alsink.reportAlignment(
q, // query
gfmFw, // forward index
gfmBw, // backward index
topf, // top of SA range in forward index
botf, // bottom of SA range in forward index
topb, // top of SA range in backward index
botb, // bottom of SA range in backward index
descid_, // Descent at the leaf
rid_, // root id
e.e, // extra edit, if necessary
best.pen, // penalty
df, // factory with Descent
pf, // factory with DescentPoss
rs, // roots
cs); // configs
assert(alsink.repOk());
return;
}
assert(al5pi_new != 0 || al5pf_new != q.length() - 1);
TDescentId id = df.alloc();
bool succ = df[id].init(
q, // query
rid_, // root id
sc, // scoring scheme
minsc, // minimum score
maxpen, // maximum penalty
al5pi_new, // new near-5' extreme
al5pf_new, // new far-5' extreme
topf, // SA range top in FW index
botf, // SA range bottom in FW index
topb, // SA range top in BW index
botb, // SA range bottom in BW index
l2r, // direction this descent will go in
id, // my ID
descid_, // parent ID
best.pen, // total penalties so far
e.e, // edit for incoming edge; uninitialized if bounced
gfmFw, // forward index
gfmBw, // mirror index
re, // redundancy checker
df, // Descent factory
pf, // DescentPos factory
rs, // DescentRoot list
cs, // DescentConfig list
heap, // heap
alsink, // alignment sink
met, // metrics
prm); // per-read metrics
if(!succ) {
// Reclaim memory we had used for this descent and its DescentPos info
df.resize(dfsz);
pf.resize(pfsz);
}
break;
}
if(!empty()) {
// Re-insert this Descent with its new priority
heap.insert(make_pair(out_.bestPri(), descid_));
}
}
/**
* Given the forward and backward indexes, and given topf/botf/topb/botb, get
* tloc, bloc ready for the next step.
*/
template <typename index_t>
void Descent<index_t>::nextLocsBi(
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
SideLocus<index_t>& tloc, // top locus
SideLocus<index_t>& bloc, // bot locus
index_t topf, // top in BWT
index_t botf, // bot in BWT
index_t topb, // top in BWT'
index_t botb) // bot in BWT'
{
assert_gt(botf, 0);
// Which direction are we going in next?
if(l2r_) {
// Left to right; use BWT'
if(botb - topb == 1) {
// Already down to 1 row; just init top locus
tloc.initFromRow(topb, gfmBw.gh(), gfmBw.gfm());
bloc.invalidate();
} else {
SideLocus<index_t>::initFromTopBot(
topb, botb, gfmBw.gh(), gfmBw.gfm(), tloc, bloc);
assert(bloc.valid());
}
} else {
// Right to left; use BWT
if(botf - topf == 1) {
// Already down to 1 row; just init top locus
tloc.initFromRow(topf, gfmFw.gh(), gfmFw.gfm());
bloc.invalidate();
} else {
SideLocus<index_t>::initFromTopBot(
topf, botf, gfmFw.gh(), gfmFw.gfm(), tloc, bloc);
assert(bloc.valid());
}
}
// Check if we should update the tracker with this refinement
assert(botf - topf == 1 || bloc.valid());
assert(botf - topf > 1 || !bloc.valid());
}
/**
* Advance this descent by following read matches as far as possible.
*
* This routine doesn't have to consider the whole gamut of constraints on
* which outgoing edges can be followed. If it is a root descent, it does have
* to know how deep the no-edit constraint goes, though, so we can decide
* whether using the ftab would potentially jump over relevant branch points.
* Apart from that, though, we simply proceed as far as it can go by matching
* characters in the query, irrespective of the constraints.
* recalcOutgoing(...) and followBestOutgoing(...) do have to consider these
* constraints, though.
*
* Conceptually, as we make descending steps, we have:
* 1. Before each step, a single range indicating how we departed the previous
* step
* 2. As part of each step, a quad of ranges indicating what range would result
* if we proceeded on an a, c, g ot t
*
* Return true iff it is possible to branch from this descent. If we haven't
* exceeded the no-branch depth.
*/
template <typename index_t>
bool Descent<index_t>::followMatches(
const Read& q, // query string
const Scoring& sc, // scoring scheme
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent<index_t> >& df, // Descent factory
EFactory<DescentPos>& pf, // DescentPos factory
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm, // per-read metrics
bool& branches, // out: true -> there are > 0 ways to branch
bool& hitEnd, // out: true -> hit read end with non-empty range
bool& done, // out: true -> we made a full alignment
TReadOff& off5p_i, // out: initial 5' offset
TIndexOffU& topf_bounce, // out: top of SA range for fw idx for bounce
TIndexOffU& botf_bounce, // out: bot of SA range for fw idx for bounce
TIndexOffU& topb_bounce, // out: top of SA range for bw idx for bounce
TIndexOffU& botb_bounce) // out: bot of SA range for bw idx for bounce
{
// TODO: make these full-fledged parameters
size_t nobranchDepth = 20;
bool stopOnN = true;
assert(q.repOk());
assert(repOk(&q));
assert_eq(gfmFw.eh().ftabChars(), gfmBw.gh().ftabChars());
#ifndef NDEBUG
for(int i = 0; i < 4; i++) {
assert_eq(gfmFw.fchr()[i], gfmBw.fchr()[i]);
}
#endif
SideLocus<index_t> tloc, bloc;
TIndexOffU topf = topf_, botf = botf_, topb = topb_, botb = botb_;
bool fw = rs[rid_].fw;
bool toward3p;
size_t off5p;
assert_lt(al5pi_, q.length());
assert_lt(al5pf_, q.length());
while(true) {
toward3p = (l2r_ == fw);
assert_geq(al5pf_, al5pi_);
assert(al5pi_ != 0 || al5pf_ != q.length() - 1);
if(toward3p) {
if(al5pf_ == q.length()-1) {
l2r_ = !l2r_;
continue;
}
if(al5pi_ == al5pf_ && root()) {
off5p = off5p_i = al5pi_;
} else {
off5p = off5p_i = (al5pf_ + 1);
}
} else {
if(al5pi_ == 0) {
l2r_ = !l2r_;
continue;
}
assert_gt(al5pi_, 0);
if(al5pi_ == al5pf_ && root()) {
off5p = off5p_i = al5pi_;
} else {
off5p = off5p_i = (al5pi_ - 1);
}
}
break;
}
size_t off3p = q.length() - off5p - 1;
assert_lt(off5p, q.length());
assert_lt(off3p, q.length());
bool firstPos = true;
assert_eq(0, len_);
// Number of times pf.alloc() is called. So we can sanity check it.
size_t nalloc = 0;
// Set to true as soon as we encounter a branch point along this descent.
branches = false;
// hitEnd is set to true iff this edit pushes us to the extreme 5' or 3'
// end of the alignment
hitEnd = false;
// done is set to true iff this edit aligns the only remaining character of
// the read
done = false;
if(root()) {
assert_eq(al5pi_, al5pf_);
// Check whether/how far we can jump using ftab
int ftabLen = gfmFw.gh().ftabChars();
bool ftabFits = true;
if(toward3p && ftabLen + off5p > q.length()) {
ftabFits = false;
} else if(!toward3p && off5p < (size_t)ftabLen) {
ftabFits = false;
}
bool useFtab = ftabLen > 1 && (size_t)ftabLen <= nobranchDepth && ftabFits;
bool ftabFailed = false;
if(useFtab) {
prm.nFtabs++;
// Forward index: right-to-left
size_t off_r2l = fw ? off5p : q.length() - off5p - 1;
if(l2r_) {
//
} else {
assert_geq((int)off_r2l, ftabLen - 1);
off_r2l -= (ftabLen - 1);
}
bool ret = gfmFw.ftabLoHi(fw ? q.patFw : q.patRc, off_r2l,
false, // reverse
topf, botf);
if(!ret) {
// Encountered an N or something else that made it impossible
// to use the ftab
ftabFailed = true;
} else {
if(botf - topf == 0) {
return false;
}
int c_r2l = fw ? q.patFw[off_r2l] : q.patRc[off_r2l];
// Backward index: left-to-right
size_t off_l2r = fw ? off5p : q.length() - off5p - 1;
if(l2r_) {
//
} else {
assert_geq((int)off_l2r, ftabLen - 1);
off_l2r -= (ftabLen - 1);
}
ASSERT_ONLY(bool ret2 = )
gfmBw.ftabLoHi(fw ? q.patFw : q.patRc, off_l2r,
false, // don't reverse
topb, botb);
assert(ret == ret2);
int c_l2r = fw ? q.patFw[off_l2r + ftabLen - 1] :
q.patRc[off_l2r + ftabLen - 1];
assert_eq(botf - topf, botb - topb);
if(toward3p) {
assert_geq((int)off3p, ftabLen - 1);
off5p += ftabLen; off3p -= ftabLen;
} else {
assert_geq((int)off5p, ftabLen - 1);
off5p -= ftabLen; off3p += ftabLen;
}
len_ += ftabLen;
if(toward3p) {
// By convention, al5pf_ and al5pi_ start out equal, so we only
// advance al5pf_ by ftabLen - 1 (not ftabLen)
al5pf_ += (ftabLen - 1); // -1 accounts for inclusive al5pf_
if(al5pf_ == q.length() - 1) {
hitEnd = true;
done = (al5pi_ == 0);
}
} else {
// By convention, al5pf_ and al5pi_ start out equal, so we only
// advance al5pi_ by ftabLen - 1 (not ftabLen)
al5pi_ -= (ftabLen - 1);
if(al5pi_ == 0) {
hitEnd = true;
done = (al5pf_ == q.length()-1);
}
}
// Allocate DescentPos data structures and leave them empty. We
// jumped over them by doing our lookup in the ftab, so we have no
// info about outgoing edges from them, besides the matching
// outgoing edge from the last pos which is in topf/botf and
// topb/botb.
size_t id = 0;
if(firstPos) {
posid_ = pf.alloc();
pf[posid_].reset();
firstPos = false;
for(int i = 1; i < ftabLen; i++) {
id = pf.alloc();
pf[id].reset();
}
} else {
for(int i = 0; i < ftabLen; i++) {
id = pf.alloc();
pf[id].reset();
}
}
assert_eq(botf-topf, botb-topb);
pf[id].c = l2r_ ? c_l2r : c_r2l;
pf[id].topf[l2r_ ? c_l2r : c_r2l] = topf;
pf[id].botf[l2r_ ? c_l2r : c_r2l] = botf;
pf[id].topb[l2r_ ? c_l2r : c_r2l] = topb;
pf[id].botb[l2r_ ? c_l2r : c_r2l] = botb;
assert(pf[id].inited());
nalloc += ftabLen;
}
}
if(!useFtab || ftabFailed) {
// Can't use ftab, use fchr instead
int rdc = q.getc(off5p, fw);
// If rdc is N, that's pretty bad! That means we placed a root
// right on an N. The only thing we can reasonably do is to pick a
// nucleotide at random and proceed.
if(rdc > 3) {
return false;
}
assert_range(0, 3, rdc);
topf = topb = gfmFw.fchr()[rdc];
botf = botb = gfmFw.fchr()[rdc+1];
if(botf - topf == 0) {
return false;
}
if(toward3p) {
off5p++; off3p--;
} else {
off5p--; off3p++;
}
len_++;
if(toward3p) {
if(al5pf_ == q.length()-1) {
hitEnd = true;
done = (al5pi_ == 0);
}
} else {
if(al5pi_ == 0) {
hitEnd = true;
done = (al5pf_ == q.length()-1);
}
}
// Allocate DescentPos data structure. We could fill it with the
// four ranges from fchr if we wanted to, but that will never be
// relevant.
size_t id = 0;
if(firstPos) {
posid_ = id = pf.alloc();
firstPos = false;
} else {
id = pf.alloc();
}
assert_eq(botf-topf, botb-topb);
pf[id].c = rdc;
pf[id].topf[rdc] = topf;
pf[id].botf[rdc] = botf;
pf[id].topb[rdc] = topb;
pf[id].botb[rdc] = botb;
assert(pf[id].inited());
nalloc++;
}
assert_gt(botf, topf);
assert_eq(botf - topf, botb - topb);
// Check if this is redundant with an already-explored path
if(!re.check(fw, l2r_, al5pi_, al5pf_, al5pf_ - al5pi_ + 1 + gapadd_,
topf, botf, pen_))
{
prm.nRedSkip++;
return false;
}
prm.nRedFail++; // not pruned by redundancy list
prm.nRedIns++; // inserted into redundancy list
}
if(done) {
Edit eempty;
alsink.reportAlignment(
q, // query
gfmFw, // forward index
gfmBw, // backward index
topf, // top of SA range in forward index
botf, // bottom of SA range in forward index
topb, // top of SA range in backward index
botb, // bottom of SA range in backward index
descid_, // Descent at the leaf
rid_, // root id
eempty, // extra edit, if necessary
pen_, // penalty
df, // factory with Descent
pf, // factory with DescentPoss
rs, // roots
cs); // configs
assert(alsink.repOk());
return true;
} else if(hitEnd) {
assert(botf > 0 || topf > 0);
assert_gt(botf, topf);
topf_bounce = topf;
botf_bounce = botf;
topb_bounce = topb;
botb_bounce = botb;
return true; // Bounced
}
// We just advanced either ftabLen characters, or 1 character,
// depending on whether we used ftab or fchr.
nextLocsBi(gfmFw, gfmBw, tloc, bloc, topf, botf, topb, botb);
assert(tloc.valid());
assert(botf - topf == 1 || bloc.valid());
assert(botf - topf > 1 || !bloc.valid());
TIndexOffU t[4], b[4]; // dest BW ranges
TIndexOffU tp[4], bp[4]; // dest BW ranges for "prime" index
ASSERT_ONLY(TIndexOff lasttot = botf - topf);
bool fail = false;
while(!fail && !hitEnd) {
assert(!done);
int rdc = q.getc(off5p, fw);
int rdq = q.getq(off5p);
assert_range(0, 4, rdc);
assert_gt(botf, topf);
assert(botf - topf == 1 || bloc.valid());
assert(botf - topf > 1 || !bloc.valid());
assert(tloc.valid());
TIndexOffU width = botf - topf;
bool ltr = l2r_;
const GFM<index_t>& gfm = ltr ? gfmBw : gfmFw;
t[0] = t[1] = t[2] = t[3] = b[0] = b[1] = b[2] = b[3] = 0;
int only = -1; // if we only get 1 non-empty range, this is the char
size_t nopts = 1;
if(bloc.valid()) {
// Set up initial values for the primes
if(ltr) {
tp[0] = tp[1] = tp[2] = tp[3] = topf;
bp[0] = bp[1] = bp[2] = bp[3] = botf;
} else {
tp[0] = tp[1] = tp[2] = tp[3] = topb;
bp[0] = bp[1] = bp[2] = bp[3] = botb;
}
// Range delimited by tloc/bloc has size >1. If size == 1,
// we use a simpler query (see if(!bloc.valid()) blocks below)
met.bwops++;
met.bwops_bi++;
prm.nSdFmops++;
if(prm.doFmString) {
prm.fmString.add(false, pen_, 1);
}
gfm.mapBiLFEx(tloc, bloc, t, b, tp, bp);
// t, b, tp and bp now filled
ASSERT_ONLY(TIndexOffU tot = (b[0]-t[0])+(b[1]-t[1])+(b[2]-t[2])+(b[3]-t[3]));
ASSERT_ONLY(TIndexOffU totp = (bp[0]-tp[0])+(bp[1]-tp[1])+(bp[2]-tp[2])+(bp[3]-tp[3]));
assert_eq(tot, totp);
assert_leq(tot, lasttot);
ASSERT_ONLY(lasttot = tot);
fail = (rdc > 3 || b[rdc] <= t[rdc]);
size_t nopts = 0;
if(b[0] > t[0]) { nopts++; only = 0; }
if(b[1] > t[1]) { nopts++; only = 1; }
if(b[2] > t[2]) { nopts++; only = 2; }
if(b[3] > t[3]) { nopts++; only = 3; }
if(!fail && b[rdc] - t[rdc] < width) {
branches = true;
}
} else {
tp[0] = tp[1] = tp[2] = tp[3] = bp[0] = bp[1] = bp[2] = bp[3] = 0;
// Range delimited by tloc/bloc has size 1
TIndexOffU ntop = ltr ? topb : topf;
met.bwops++;
met.bwops_1++;
prm.nSdFmops++;
if(prm.doFmString) {
prm.fmString.add(false, pen_, 1);
}
int cc = gfm.mapLF1(ntop, tloc);
assert_range(-1, 3, cc);
fail = (cc != rdc);
if(fail) {
branches = true;
}
if(cc >= 0) {
only = cc;
t[cc] = ntop; b[cc] = ntop+1;
tp[cc] = ltr ? topf : topb;
bp[cc] = ltr ? botf : botb;
}
}
// Now figure out what to do with our N.
int origRdc = rdc;
if(rdc == 4) {
fail = true;
} else {
topf = ltr ? tp[rdc] : t[rdc];
botf = ltr ? bp[rdc] : b[rdc];
topb = ltr ? t[rdc] : tp[rdc];
botb = ltr ? b[rdc] : bp[rdc];
assert_eq(botf - topf, botb - topb);
}
// The trouble with !stopOnN is that we don't have a way to store the N
// edits. There could be several per Descent.
if(rdc == 4 && !stopOnN && nopts == 1) {
fail = false;
rdc = only;
int pen = sc.n(rdq);
assert_gt(pen, 0);
pen_ += pen;
}
assert_range(0, 4, origRdc);
assert_range(0, 4, rdc);
// If 'fail' is true, we failed to align this read character. We still
// install the SA ranges into the DescentPos and increment len_ in this
// case.
// Convert t, tp, b, bp info tf, bf, tb, bb
TIndexOffU *tf = ltr ? tp : t;
TIndexOffU *bf = ltr ? bp : b;
TIndexOffU *tb = ltr ? t : tp;
TIndexOffU *bb = ltr ? b : bp;
// Allocate DescentPos data structure.
if(firstPos) {
posid_ = pf.alloc();
firstPos = false;
} else {
pf.alloc();
}
nalloc++;
pf[posid_ + len_].reset();
pf[posid_ + len_].c = origRdc;
for(size_t i = 0; i < 4; i++) {
pf[posid_ + len_].topf[i] = tf[i];
pf[posid_ + len_].botf[i] = bf[i];
pf[posid_ + len_].topb[i] = tb[i];
pf[posid_ + len_].botb[i] = bb[i];
assert_eq(pf[posid_ + len_].botf[i] - pf[posid_ + len_].topf[i],
pf[posid_ + len_].botb[i] - pf[posid_ + len_].topb[i]);
}
if(!fail) {
// Check if this is redundant with an already-explored path
size_t al5pf = al5pf_, al5pi = al5pi_;
if(toward3p) {
al5pf++;
} else {
al5pi--;
}
fail = !re.check(fw, l2r_, al5pi, al5pf,
al5pf - al5pi + 1 + gapadd_, topf, botf, pen_);
if(fail) {
prm.nRedSkip++;
} else {
prm.nRedFail++; // not pruned by redundancy list
prm.nRedIns++; // inserted into redundancy list
}
}
if(!fail) {
len_++;
if(toward3p) {
al5pf_++;
off5p++;
off3p--;
if(al5pf_ == q.length() - 1) {
hitEnd = true;
done = (al5pi_ == 0);
}
} else {
assert_gt(al5pi_, 0);
al5pi_--;
off5p--;
off3p++;
if(al5pi_ == 0) {
hitEnd = true;
done = (al5pf_ == q.length() - 1);
}
}
}
if(!fail && !hitEnd) {
nextLocsBi(gfmFw, gfmBw, tloc, bloc, tf[rdc], bf[rdc], tb[rdc], bb[rdc]);
}
}
assert_geq(al5pf_, al5pi_);
assert(!root() || al5pf_ - al5pi_ + 1 == nalloc || al5pf_ - al5pi_ + 2 == nalloc);
assert_geq(pf.size(), nalloc);
if(done) {
Edit eempty;
alsink.reportAlignment(
q, // query
gfmFw, // forward index
gfmBw, // backward index
topf, // top of SA range in forward index
botf, // bottom of SA range in forward index
topb, // top of SA range in backward index
botb, // bottom of SA range in backward index
descid_, // Descent at the leaf
rid_, // root id
eempty, // extra edit, if necessary
pen_, // penalty
df, // factory with Descent
pf, // factory with DescentPoss
rs, // roots
cs); // configs
assert(alsink.repOk());
return true;
} else if(hitEnd) {
assert(botf > 0 || topf > 0);
assert_gt(botf, topf);
topf_bounce = topf;
botf_bounce = botf;
topb_bounce = topb;
botb_bounce = botb;
return true; // Bounced
}
assert(repOk(&q));
assert(!hitEnd || topf_bounce > 0 || botf_bounce > 0);
return true;
}
#endif