179 lines
4.9 KiB
Perl
179 lines
4.9 KiB
Perl
|
#!/usr/bin/perl -w
|
||
|
|
||
|
#
|
||
|
# Copyright 2011, Ben Langmead <langmea@cs.jhu.edu>
|
||
|
#
|
||
|
# This file is part of Bowtie 2.
|
||
|
#
|
||
|
# Bowtie 2 is free software: you can redistribute it and/or modify
|
||
|
# it under the terms of the GNU General Public License as published by
|
||
|
# the Free Software Foundation, either version 3 of the License, or
|
||
|
# (at your option) any later version.
|
||
|
#
|
||
|
# Bowtie 2 is distributed in the hope that it will be useful,
|
||
|
# but WITHOUT ANY WARRANTY; without even the implied warranty of
|
||
|
# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
|
||
|
# GNU General Public License for more details.
|
||
|
#
|
||
|
# You should have received a copy of the GNU General Public License
|
||
|
# along with Bowtie 2. If not, see <http://www.gnu.org/licenses/>.
|
||
|
#
|
||
|
|
||
|
package Read;
|
||
|
use strict;
|
||
|
use Carp;
|
||
|
use FindBin qw($Bin);
|
||
|
use lib $Bin;
|
||
|
use DNA;
|
||
|
use Test;
|
||
|
|
||
|
sub new {
|
||
|
my ($class, $name, $seq, $qual, $color, $fw, $orig) = @_;
|
||
|
$name = "noname" unless defined($name);
|
||
|
return bless {
|
||
|
_name => $name,
|
||
|
_seq => $seq || croak("No sequence"),
|
||
|
_qual => $qual || croak("No qualities"),
|
||
|
_color => $color || 0,
|
||
|
_fw => $fw || croak("No orientation"),
|
||
|
_orig => $orig || croak("No original read string")
|
||
|
}, $class;
|
||
|
}
|
||
|
sub name { return $_[0]->{_name} }
|
||
|
sub seq { return $_[0]->{_seq} }
|
||
|
sub qual { return $_[0]->{_qual} }
|
||
|
sub color { return $_[0]->{_color} }
|
||
|
sub fw { return $_[0]->{_fw} }
|
||
|
sub orig { return $_[0]->{_orig} }
|
||
|
sub len { return length($_[0]->seq()) }
|
||
|
|
||
|
##
|
||
|
# Obtain a character from the read.
|
||
|
#
|
||
|
sub at {
|
||
|
my ($self, $off, $ori) = @_;
|
||
|
my ($c, $q) = "";
|
||
|
if($ori eq "RtL") {
|
||
|
$c = uc substr($self->seq(), -$off-1, 1);
|
||
|
$q = substr($self->qual(), -$off-1, 1);
|
||
|
} else {
|
||
|
$c = uc substr($self->seq(), $off, 1);
|
||
|
$q = substr($self->qual(), $off, 1);
|
||
|
}
|
||
|
length($c) == 1 || die;
|
||
|
return ($c, $q);
|
||
|
}
|
||
|
|
||
|
##
|
||
|
# Load a set of FASTQ reads into the given reads array.
|
||
|
#
|
||
|
sub fromFastq {
|
||
|
my ($fh, $color, $reads) = @_;
|
||
|
$reads = [] unless defined($reads);
|
||
|
while(<$fh>) {
|
||
|
my $l1 = $_;
|
||
|
my $l2 = <$fh>; defined($l2) || croak("Name line followed by EOF");
|
||
|
my $l3 = <$fh>; defined($l3) || croak("Sequence line followed by EOF");
|
||
|
my $l4 = <$fh>; defined($l4) || croak("Name2 line followed by EOF");
|
||
|
my $orig = "$l1$l2$l3$l4";
|
||
|
chomp($l1); chomp($l2); chomp($l3); chomp($l4);
|
||
|
push @{$reads}, Read->new(substr($l1, 1), $l2, $l4, $color, "FW", $orig);
|
||
|
}
|
||
|
return $reads;
|
||
|
}
|
||
|
|
||
|
##
|
||
|
# Load a set of FASTQ reads into the given reads array.
|
||
|
#
|
||
|
sub fromFastqs {
|
||
|
my ($fqs, $color, $reads) = @_;
|
||
|
$reads = [] unless defined($reads);
|
||
|
for my $f (@$fqs) {
|
||
|
my $fqfh;
|
||
|
open($fqfh, $f =~ /\.gz$/ ? "gzip -dc $f |" : "$f") || croak("Could not open $f for reading");
|
||
|
fromFastq($fqfh, $color, $reads);
|
||
|
close($fqfh);
|
||
|
}
|
||
|
return $reads;
|
||
|
}
|
||
|
|
||
|
##
|
||
|
# Load a set of FASTA reads into the given reads array.
|
||
|
#
|
||
|
sub fromFasta {
|
||
|
my ($fh, $color, $reads) = @_;
|
||
|
$reads = [] unless defined($reads);
|
||
|
while(<$fh>) {
|
||
|
my $l1 = $_;
|
||
|
my $l2 = <$fh>; defined($l2) || croak("Name line followed by EOF");
|
||
|
my $orig = "$l1$l2";
|
||
|
chomp($l1); chomp($l2);
|
||
|
my $qual = "I" x length($l2);
|
||
|
push @{$reads}, Read->new(substr($l1, 1), $l2, $qual, $color, "FW", $orig);
|
||
|
}
|
||
|
return $reads;
|
||
|
}
|
||
|
|
||
|
##
|
||
|
# Load a set of FASTA reads into the given reads array.
|
||
|
#
|
||
|
sub fromFastas {
|
||
|
my ($fas, $color, $reads) = @_;
|
||
|
$reads = [] unless defined($reads);
|
||
|
for my $f (@$fas) {
|
||
|
my $fafh;
|
||
|
open($fafh, $f =~ /\.gz$/ ? "gzip -dc $f |" : "$f") || croak("Could not open $f for reading");
|
||
|
fromFasta($fafh, $color, $reads);
|
||
|
close($fafh);
|
||
|
}
|
||
|
return $reads;
|
||
|
}
|
||
|
|
||
|
##
|
||
|
# Load a set of FASTA reads into the given reads array.
|
||
|
#
|
||
|
sub fromStrings {
|
||
|
my ($strs, $color, $reads) = @_;
|
||
|
$reads = [] unless defined($reads);
|
||
|
my $idx = 0;
|
||
|
for my $str (@$strs) {
|
||
|
my $qual = "I" x length($str);
|
||
|
push @{$reads}, new Read($idx, $str, $qual, $color, "FW", $str);
|
||
|
$idx++;
|
||
|
}
|
||
|
return $reads;
|
||
|
}
|
||
|
|
||
|
sub test1 {
|
||
|
my $r = new Read("blah", "TTACGAACCACAACGTATCG", "I"x20, 0, "FW", "?");
|
||
|
my ($c, $q) = $r->at(0, "LtR");
|
||
|
($c eq "T" && $q eq "I") || croak("Expected (T, I), got ($c, $q)\n");
|
||
|
($c, $q) = $r->at(0, "RtL");
|
||
|
($c eq "G" && $q eq "I") || croak("Expected (G, I), got ($c, $q)\n");
|
||
|
($c, $q) = $r->at(1, "LtR");
|
||
|
($c eq "T" && $q eq "I") || croak("Expected (T, I), got ($c, $q)\n");
|
||
|
($c, $q) = $r->at(1, "RtL");
|
||
|
($c eq "C" && $q eq "I") || croak("Expected (C, I), got ($c, $q)\n");
|
||
|
return 1;
|
||
|
}
|
||
|
|
||
|
sub test2 {
|
||
|
my $rs = fromStrings(["ACGATGCTACG", "TGACGATGCTAG"], 0);
|
||
|
$rs->[0]->seq() eq "ACGATGCTACG" || croak($rs->[0]->seq());
|
||
|
$rs->[0]->qual() eq "IIIIIIIIIII" || croak($rs->[0]->qual());
|
||
|
$rs->[0]->name() eq "0" || croak($rs->[0]->name());
|
||
|
$rs->[1]->seq() eq "TGACGATGCTAG" || croak($rs->[1]->seq());
|
||
|
$rs->[1]->qual() eq "IIIIIIIIIIII" || croak($rs->[1]->qual());
|
||
|
$rs->[1]->name() eq "1" || croak($rs->[1]->name());
|
||
|
return 1;
|
||
|
}
|
||
|
|
||
|
if($0 =~ /Read\.pm$/) {
|
||
|
print "Running unit tests\n";
|
||
|
# Run unit tests
|
||
|
print "Test \"test1\"..."; test1(); print "PASSED\n";
|
||
|
print "Test \"test2\"..."; test2(); print "PASSED\n";
|
||
|
}
|
||
|
|
||
|
1;
|